Text Size:AAA

Human LRPAP1 Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LRPAP1cDNA Clone Product Information
Gene Bank Ref.ID:NM_002337.2
cDNA Size:1074
cDNA Description:ORF Clone of Homo sapiens low density lipoprotein receptor-related protein associated protein 1 DNA.
Gene Synonym:RAP, MRAP, A2RAP, HBP44, A2MRAP, MGC138272
Species:Human
Vector:pCMV/hygro-Myc
Restriction Site:KpnI + XbaI
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:Identical with the Gene Bank Ref.ID sequence.
Shipping Carrier:Whatman FTA elute card (Cat: WB120410) contains 5-10 μg of plasmid.
Storage:The Whatman FTA elute card can be stored at room temperature for three months under dry condition.
Image
Human LRPAP1 Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged

pCMV/hygro-Myc vector information
Vector Name pCMV/hygro-Myc
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV/hygro-Myc Physical Map

Schematic of pCMV/hygro-Myc Multiple Cloning Sites

Myc tag info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Wnt Receptor Related Products
Background

Receptor-associated protein (RAP) is a molecular chaperone for low density lipoprotein receptor-related protein (LRP), which plays a key role in cholesterol metabolism. The lipoprotein receptor-related protein (LRP) is an endocytic receptor for several ligands, such as alpha2-macroglobulin (alpha2 M) and apolipoprotein E. LRP is involved in the clearance of lipids from the bloodstream and is expressed in the atherosclerotic plaque. The LRP-associated protein (LRPAP in humans, RAP in mice) acts as a chaperone protein, stabilizing the nascent LRP peptide in the endoplasmic reticulum and Golgi complex. Alpha-2-macroglobulin receptor-associated protein, also known as low density lipoprotein receptor-related protein-associated protein 1, RAP and LRPAP1, is a 39 kDa protein and a member of the alpha-2-MRAP family. It is a receptor antagonist that interacts with several members of the low density lipoprotein (LDL) receptor gene family. Upon binding to these receptors, LRPAP1 inhibits all ligand interactions with the receptors. LRPAP1 is present on cell surface forming a complex with the alpha-2-macroglobulin receptor heavy and light chains. It binds with LRP1B and the binding is followed by internalization and degradation. LRPAP1 interacts with LRP1/alpha-2-macroglobulin receptor and LRP2 (previously called glycoprotein 330), and may be involved in the pathogenesis of membrane glomerular nephritis. LRPAP1 together with LRP2 forms the Heymann nephritis antigenic complex. LRP2 is expressed in epithelial cells of the thyroid, where it can serve as a receptor for the protein thyroglobulin. Intron 5 insertion/deletion polymorphism of RAP gene (LRPAP1) has been implicated in other diseases sharing etiology with gallstone disease (GSD). The LRPAP1 insertion/deletion polymorphism influences cholesterol homeostasis and may confer risk for gallstone disease and gallbladder carcinoma (GBC) incidence usually parallels with the prevalence of cholelithiosis. The genetic variations at the LRPAP1 locus may modulate Alzheimer disease (AD) phenotype beyond risk for disease. In addition, the variation at the LRPAP1 gene could contribute to the risk of developing an early episode of myocardial infarction (MI).

References
  • Gonzlez P, et al. (2002) Variation in the lipoprotein receptor-related protein, alpha2-macroglobulin and lipoprotein receptor-associated protein genes in relation to plasma lipid levels and risk of early myocardial infarction. Coron Artery Dis. 13(5): 251-4.
  • Schutte DL, et al. (2003) A LRPAP1 intronic insertion/deletion polymorphism and phenotypic variability in Alzheimer disease. Res Theory Nurs Pract. 17(4): 301-19?
  • Pandey SN, et al. (2006) Lipoprotein receptor associated protein (LRPAP1) insertion/deletion polymorphism: association with gallbladder cancer susceptibility. Int J Gastrointest Cancer. 37(4): 124-8.
  • Dixit M, et al. (2006) Association of low density lipoprotein receptor related protein-associated protein (LRPAP1) gene insertion/deletion polymorphism with gallstone disease.J Gastroenterol Hepatol. 21(5): 847-9.
  • Catalog:HG11100-M-M
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    5 business days
    Images
    • Human LRPAP1 Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"