_×
Human LRAP / ERAP2 Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged
  0 products, total $0.+86-400-890-9989      Login |  Register 中文한국어

Browse By Molecule:

Your Position: Home > Gene Products > Expression-ready cDNA Clones > Human LRAP / ERAP2 Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged

Human LRAP / ERAP2 Gene cDNA Clone (full-length ORF Clone), expression ready, Myc-tagged

Catalog Vector (Price) Quantity In Stock Operation
HG10734-M-M
  YES

*  pCMV vectors are ALL featured with a CMV promoter and a hygromycin-resistance (hygro) gene. These plasmids can be used directly in mammalian cell expression. Learn more about pCMV vectors.

Antibody Production Services

LRAP / ERAP2 cDNA Clone Datasheet

 

LRAP / ERAP2 cDNA Clone Product Information

Gene Bank Ref.ID:

NM_022350.3

cDNA Size:

2883

Gene Synonym:

LRAP; L-RAP; FLJ23633; FLJ23701; FLJ23807; ERAP2

Source: Human

LRAP / ERAP2 cDNA Clone Description

cDNA Description:

ORF Clone of Homo sapiens endoplasmic reticulum aminopeptidase 2 DNA.

Vector:

pCMV/hygro-Myc

Myc Tag Sequence: CAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description: Identical with the Gene Bank Ref. ID sequence except for the point mutations 1305 T/A, 1689 G/A, 2229 C/T, 2325 C/T and 2611 C/T not causing the amino acid variation.

LRAP / ERAP2 cDNA Clone Shipping

  1. 5-10μg Plasmid DNA is shipped on Whatman FTA elute card (Cat. No.: WB120410) at room temperature.
  2. It would take 7-14 days for delivery typically. For bulk orders, additional 1-2 weeks would be needed.

LRAP / ERAP2 cDNA Clone Usage Protocol

  1. Cut along the circle edge of the spot (arrow points to) to get the filter paper.
  2. Transfer the filter paper to a 1.5ml microfuge tube containing 150-200 μl of sterile H2O Ensure the filter is completely immersed in the H2O Briefly centrifuge the tube for 10 seconds.
  3. Incubate the tube at 95℃ for 15-30 min.
  4. At the end of the incubation pulse vortex, or gently tap the tube.
  5. Briefly centrifuge for 30 seconds, to separate the matrix from the elute. The elute now contains the purified DNA.

LRAP / ERAP2 cDNA Clone Sequence and Quality Control

Sequence:

1        ATGTTCCATT CTTCTGCAAT GGTTAATTCA CACAGAAAAC CAATGTTTAA CATTCACAGA
61       GGATTTTACT GCTTAACAGC CATCTTGCCC CAAATATGCA TTTGTTCTCA GTTCTCAGTG
121      CCATCTAGTT ATCACTTCAC TGAGGATCCT GGGGCTTTCC CAGTAGCCAC TAATGGGGAA
181      CGATTTCCTT GGCAGGAGCT AAGGCTCCCC AGTGTGGTCA TTCCTCTCCA TTATGACCTC
241      TTTGTCCACC CCAATCTCAC CTCTCTGGAC TTTGTTGCAT CTGAGAAGAT CGAAGTCTTG
301      GTCAGCAATG CTACCCAGTT TATCATCTTG CACAGCAAAG ATCTTGAAAT CACGAATGCC
361      ACCCTTCAGT CAGAGGAAGA TTCAAGATAC ATGAAACCAG GAAAAGAACT GAAAGTTTTG
421      AGTTACCCTG CTCATGAACA AATTGCACTG CTGGTTCCAG AGAAACTTAC GCCTCACCTG
481      AAATACTATG TGGCTATGGA CTTCCAAGCC AAGTTAGGTG ATGGCTTTGA AGGGTTTTAT
541      AAAAGCACAT ACAGAACTCT TGGTGGTGAA ACAAGAATTC TTGCAGTAAC AGATTTTGAG
601      CCAACCCAGG CACGCATGGC TTTCCCTTGC TTTGATGAAC CGTTGTTCAA AGCCAACTTT
661      TCAATCAAGA TACGAAGAGA GAGCAGGCAT ATTGCACTAT CCAACATGCC AAAGGTTAAG
721      ACAATTGAAC TTGAAGGAGG TCTTTTGGAA GATCACTTTG AAACTACTGT AAAAATGAGT
781      ACATACCTTG TAGCCTACAT AGTTTGTGAT TTCCACTCTC TGAGTGGCTT CACTTCATCA
841      GGGGTCAAGG TGTCCATCTA TGCATCCCCA GACAAACGGA ATCAAACACA TTATGCTTTG
901      CAGGCATCAC TGAAGCTACT TGATTTTTAT GAAAAGTACT TTGATATCTA CTATCCACTC
961      TCCAAACTGG ATTTAATTGC TATTCCTGAC TTTGCACCTG GAGCCATGGA AAATTGGGGC
1021     CTCATTACAT ATAGGGAGAC GTCACTGCTT TTTGACCCCA AGACCTCTTC TGCTTCCGAT
1081     AAACTGTGGG TCACCAGAGT CATAGCCCAT GAACTGGCGC ACCAGTGGTT TGGCAACCTG
1141     GTCACAATGG AATGGTGGAA TGATATTTGG CTTAAGGAGG GTTTTGCAAA ATACATGGAA
1201     CTTATCGCTG TTAATGCTAC ATATCCAGAG CTGCAATTTG ATGACTATTT TTTGAATGTG
1261     TGTTTTGAAG TAATTACAAA AGATTCATTG AATTCATCCC GCCCAATCTC CAAACCAGCG
1321     GAAACCCCGA CTCAAATACA GGAAATGTTT GATGAAGTTT CCTATAACAA GGGAGCTTGT
1381     ATTTTGAATA TGCTCAAGGA TTTTCTGGGT GAGGAGAAAT TCCAGAAAGG AATAATTCAG
1441     TACTTAAAGA AGTTCAGCTA TAGAAATGCT AAGAATGATG ACTTGTGGAG CAGTCTGTCA
1501     AATAGTTGTT TAGAAAGTGA TTTTACATCT GGTGGAGTTT GTCATTCGGA TCCCAAGATG
1561     ACAAGTAACA TGCTCGCCTT TCTGGGGGAA AATGCAGAGG TCAAAGAGAT GATGACTACA
1621     TGGACTCTCC AGAAAGGAAT CCCCCTGCTG GTGGTTAAAC AAGACGGGTG TTCACTCCGA
1681     CTGCAACAAG AGCGCTTCCT CCAGGGGGTT TTCCAGGAAG ACCCTGAATG GAGGGCCCTG
1741     CAGGAGAGGT ACCTGTGGCA TATCCCATTG ACCTACTCCA CGAGTTCTTC TAATGTGATC
1801     CACAGACACA TTCTAAAATC AAAGACAGAT ACTCTGGATC TACCTGAAAA GACCAGTTGG
1861     GTGAAATTTA ATGTGGACTC AAATGGTTAC TACATCGTTC ACTATGAGGG TCATGGATGG
1921     GACCAACTCA TTACACAGCT GAATCAGAAC CACACACTTC TCAGACCTAA GGACAGAGTA
1981     GGTCTGATTC ATGATGTGTT TCAGCTAGTT GGTGCAGGGA GACTGACCCT AGACAAAGCT
2041     CTTGACATGA CTTACTACCT CCAACATGAA ACAAGCAGCC CCGCACTTCT CGAAGGTCTG
2101     AGTTACTTGG AATCGTTTTA CCACATGATG GACAGAAGGA ATATTTCAGA TATCTCTGAA
2161     AACCTCAAGC GTTACCTTCT TCAGTATTTT AAGCCAGTGA TTGACAGGCA AAGCTGGAGT
2221     GACAAGGGTT CAGTCTGGGA CAGGATGCTC CGCTCGGCTC TCTTGAAGCT GGCCTGTGAC
2281     CTGAACCATG CTCCTTGCAT CCAGAAAGCT GCTGAACTCT TCTCTCAGTG GATGGAATCC
2341     AGTGGAAAAT TAAATATACC AACAGATGTT TTAAAGATTG TGTATTCTGT GGGTGCTCAG
2401     ACAACAGCAG GATGGAATTA CCTTTTAGAG CAATATGAAC TGTCAATGTC AAGTGCTGAA
2461     CAAAACAAAA TTCTGTATGC TTTGTCAACG AGCAAGCATC AGGAAAAGTT ACTGAAGTTA
2521     ATTGAACTAG GAATGGAAGG AAAGGTTATC AAGACACAGA ACTTGGCAGC TCTCCTTCAT
2581     GCGATTGCCA GACGTCCAAA GGGGCAGCAA TTAGCATGGG ATTTTGTAAG AGAAAATTGG
2641     ACCCATCTTC TGAAAAAATT TGACTTGGGC TCATATGACA TAAGGATGAT CATCTCTGGC
2701     ACAACAGCTC ACTTTTCTTC CAAGGATAAG TTGCAAGAGG TGAAACTATT TTTTGAATCT
2761     CTTGAGGCTC AAGGATCACA TCTGGATATT TTTCAAACTG TTCTGGAAAC GATAACCAAA
2821     AATATAAAAT GGCTGGAGAA GAATCTTCCG ACTCTGAGGA CTTGGCTAAT GGTTAATACT
2881     GCT1GAGCAGA AACTCATCTC AGAAGAGGAT CTG2TAA

 

1. GCT was the nucleotide residue from the restriction site during plasmid construction,
which has no influence on protein expression.
2. Myc Tag

 


 

Quality Control:cDNA sequencing results is available upon request.


 

 
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"