LOX-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag

1/1

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

LOX-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
822 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human oxidized low density lipoprotein (lectin-like) receptor 1.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI (two restriction sites) + XhoI
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LOX-1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LOX-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Validated Images

The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.

LOX-1 cDNA ORF Clone, Human, C-DDK (Flag®) tag: Alternative Names

CLEC8A cDNA ORF Clone, Human; LOX1 cDNA ORF Clone, Human; LOXIN cDNA ORF Clone, Human; OLR1 cDNA ORF Clone, Human; SCARE1 cDNA ORF Clone, Human; SLOX1 cDNA ORF Clone, Human

LOX-1 Background Information

Oxidized low-density lipoprotein receptor 1 (Ox-LDL receptor 1 or OLR1), also known as lectin-type oxidized LDL receptor 1 (LOX1), is a receptor protein that belongs to the C-type lectin superfamily. LOX1 is a multi-ligand receptor originally identified as the endothelial oxidized LDL receptor. OLR1 / LOX1 was isolated from an aortic endothelial cell, and recently it has been discovered in macrophages and vascular smooth muscle cells in artery vessels. The expression of LOX1 is inducted by inflammatory stimuli and oxidative stimuli. This protein binds, internalizes and degrades oxidized low-density lipoprotein. LOX1 may play an important role in the progression of vulnerable carotid plaque and might regulate vulnerable plaque formation in cooperation with MMPs and TIMP-2. In clinical, LOX1 is thought to be involved in the development of atherosclerotic lesions.
Full Name
oxidized low density lipoprotein (lectin-like) receptor 1
References
  • Hinagata J, et al. (2006) Oxidized LDL receptor LOX-1 is involved in neointimal hyperplasia after balloon arterial injury in a rat model. Cardiovasc Res. 69 (1): 263-71.
  • Melan MA, et al. (1994) The LOX1 Gene of Arabidopsis Is Temporally and Spatially Regulated in Germinating Seedlings. Plant Physiol. 105 (1): 385-93.
  • Saito A, et al. (2010) Relationship between lectin-like oxidized low-density lipoprotein receptor 1 expression and preoperative echogenic findings of vulnerable carotid plaque. Acta Neurochir (Wien). 152 (4): 589-95.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait