Text Size:AAA

Human KRAS ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human KRAS cDNA Clone Product Information
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

K-Ras belongs to the small GTPase superfamily, Ras family. As other members of the Ras family, K-Ras is a GTPase and is an early player in many signal transduction pathways. It is usually tethered to cell membranes because of the presence of an isoprenyl group on its C-terminus. K-Ras functions as a molecular on/off switch. Once it is turned on it recruits and activates proteins necessary for the propagation of growth factor and other receptors' signal, such as c-Raf and PI 3-kinase. It binds to GTP in the active state and possesses an intrinsic enzymatic activity which cleaves the terminal phosphate of the nucleotide converting it to GDP. Upon conversion of GTP to GDP, K-Ras is turned off. The rate of conversion is usually slow but can be sped up dramatically by an accessory protein of the GTPase activating protein class, for example RasGAP. In turn K-Ras can bind to proteins of the Guanine Nucleotide Exchange Factor class, for example SOS1, which forces the release of bound nucleotide. Subsequently, K-Ras binds GTP present in the cytosol and the GEF is released from ras-GTP. Besides essential function in normal tissue signaling, the mutation of a K-Ras gene is an essential step in the development of many cancers. Several germline K-Ras mutations have been found to be associated with Noonan syndrome[4] and cardio-facio-cutaneous syndrome. Somatic K-Ras mutations are found at high rates in Leukemias, colon cancer, pancreatic cancer and lung cancer.

  • Ling J, et al. (2012) KrasG12D-induced IKK2//NF-B activation by IL-1 alpha and p62 feedforward loops is required for development of pancreatic ductal adenocarcinoma. Cancer Cell. 21(1):105-20.
  • Matallanas D, et al. (2011) Mutant K-Ras activation of the proapoptotic MST2 pathway is antagonized by wild-type K-Ras. Mol Cell. 44(6):893-906.
  • Regala RP, et al. (2011) Matrix metalloproteinase-10 promotes Kras-mediated bronchio-alveolar stem cell expansion and lung cancer formation. PLoS One. 6(10):e26439.
  • Images
    • Human KRAS Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    Recently Viewed Items