Quick Order

DatasheetReviewsRelated ProductsProtocols
Human KDM1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human KDM1 Gene Plasmid Map
Human KDM1A / KDM1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

LSD1 belongs to the flavin monoamine oxidase family. It contains 1 SWIRM domain and is a component of a RCOR/GFI/LSD1/HDAC complex. LSD1 interacts directly with GFI1 and GFI1B. LSD1 speficially removes histone H3K4me2 to H3K4me1 or H3K4me0 through a FAD-dependent oxidative reaction. When forming a complex with androgen receptor (and possibly other nuclear hormone receptors), LSD1 changes its substrates to H3K9me2. Thus LSD1 is considered to act as a coactivator or a corepressor. It may play a role in the repression of neuronal genes. Alone, LSD1 is unable to demethylate H3 'Lys-4' on nucleosomes and requires the presence of RCOR1/CoREST to achieve such activity.

  • Kusaba M, et al. (2007) Rice NON-YELLOW COLORING1 is involved in light-harvesting complex II and grana degradation during leaf senescence. Plant Cell. 19(4):1362-75.
  • Pazour GJ, et al. (2005) Proteomic analysis of a eukaryotic cilium. J Cell Biol. 170(1):103-13.
  • Merchant SS, et al. (2007) The Chlamydomonas genome reveals the evolution of key animal and plant functions. Science. 318(5848):245-50.
  • Datasheet & Documentation

    Contact Us
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.