Quick Order

Influenza B (Brisbane/60/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Influenza B HA cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:1758bp
cDNA Description:Full length Clone DNA of Influenza B (Brisbane/60/2008) Hemagglutinin with N terminal His tag.
Gene Synonym:Hemagglutinin, HA
Species:Influenza B
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACN29380.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza B (Brisbane/60/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tag on other vectors
Influenza B (B/Brisbane/60/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40016-ACG$345
Influenza B (B/Brisbane/60/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40016-ACR$345
Influenza B (B/Brisbane/60/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40016-C$315
Influenza B (Brisbane/60/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40016-CF$315
Influenza B (Brisbane/60/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40016-CH$315
Influenza B (Brisbane/60/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40016-CM$315
Influenza B (Brisbane/60/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40016-CY$315
Influenza B (Brisbane/60/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40016-NF$315
Influenza B (Brisbane/60/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40016-NH$315
Influenza B (Brisbane/60/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40016-NM$315
Influenza B (Brisbane/60/2008) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40016-NY$315
Influenza B (Brisbane/60/2008) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40016-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40016-NH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"