Quick Order

Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
H9N2 PB2 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:2280bp
cDNA Description:Full length Clone DNA of Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 with N terminal His tag.
Gene Synonym:PB2
Species:H9N2
Vector:pCMV3-N-His
Plasmid:pCMV3-His-H9N2-BB-12-PB2
Restriction Site:KpnI + XbaI (6kb + 2.33kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AGE15505.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
H9N2 PB2 Gene Plasmid Map
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, N-His tag
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, N-His tag on other vectors
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tagVG40364-ACG$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40364-ACR$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 ORF mammalian expression plasmid, N-GFPSpark tagVG40364-ANG$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40364-ANR$345
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 ORF mammalian expression plasmid (Codon Optimized), C-FLAG-taggedVG40364-CF$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40364-CH$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40364-CM$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40364-CY$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 ORF mammalian expression plasmid (Codon Optimized)VG40364-G$115
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40364-NF$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40364-NH$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, N-Myc tagVG40364-NM$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40364-NY$315
Influenza A H9N2 (A/brambling/Beijing/16/2012) polymerase Pb2 ORF mammalian expression plasmid (Codon Optimized)VG40364-UT$315
 Learn more about expression Vectors
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"