Quick Order

Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag

    DatasheetReviewsRelated ProductsProtocols
    H9N2 HA cDNA Clone Product Information
    NCBI RefSeq:
    RefSeq ORF Size:1683bp
    cDNA Description:Full length Clone DNA of Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) HA with N terminal Flag tag.
    Gene Synonym:HA1, Hemagglutinin
    Restriction Site:
    Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AAO46082.1.
    Sequencing primers:T7( 5' TAATACGACTCACTATAGGG 3' )
    Promoter:Enhanced CMV cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
    FLAG Tag Info

    FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

    The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

    Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag on other vectors
    Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11719-ACG$345
    Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG11719-ACR$345
    Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11719-C$315
    Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG11719-CF$315
    Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG11719-CH$315
    Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG11719-CM$315
    Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG11719-CY$315
    Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG11719-NF$315
    Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG11719-NH$315
    Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11719-NM$315
    Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG11719-NY$315
    Influenza A H9N2 (A/Guinea fowl/Hong Kong/WF10/99) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11719-UT$315
     Learn more about expression Vectors
    Product nameProduct name

    The influenza viral Hemagglutinin (HA) protein is a homo trimer with a receptor binding pocket on the globular head of each monomer.HA has at least 18 different antigens. These subtypes are named H1 through H18.HA has two functions. Firstly, it allows the recognition of target vertebrate cells, accomplished through the binding to these cells' sialic acid-containing receptors. Secondly, once bound it facilitates the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.The influenza virus Hemagglutinin (HA) protein is translated in cells as a single protein, HA0, or hemagglutinin precursor protein. For viral activation, hemagglutinin precursor protein (HA0) must be cleaved by a trypsin-like serine endoprotease at a specific site, normally coded for by a single basic amino acid (usually arginine) between the HA1 and HA2 domains of the protein. After cleavage, the two disulfide-bonded protein domains produce the mature form of the protein subunits as a prerequisite for the conformational change necessary for fusion and hence viral infectivity.

  • White JM, Hoffman LR, Arevalo JH, et al. (1997). "Attachment and entry of influenza virus into host cells. Pivotal roles of hemagglutinin". In Chiu W, Burnett RM, Garcea RL. Structural Biology of Viruses.
  • Suzuki Y (March 2005). "Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses". Biol. Pharm. Bull. 28 (3): 399–408.
  • Senne DA, Panigrahy B, Kawaoka Y, et al. (1996). "Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential". Avian Dis. 40 (2): 425–37
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.