Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein ORF mammalian expression plasmid, C-Flag tag

Cat: VG40110-CF

Contact us:

215-583-7898
order_us@sinobiological.com
Distributors

All Nucleocapsid / NP Reagents

CRO Services

Product recommended


All Nucleocapsid / NP Reagents

Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein ORF mammalian expression plasmid, C-Flag tag General Information

Gene

Species
H7N9
RefSeq ORF Size
1497 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AHZ59787.1.
Description
Full length Clone DNA of Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein with C terminal Flag tag.

Plasmid

Promoter
Enhanced CMV promoter
Vector
Restriction Sites
KpnI + XbaI (6kb + 1.54kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.

Screening

Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression

Storage & Shipping

Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

Nucleocapsid / NP cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein ORF mammalian expression plasmid, C-Flag tag Validated Images

other Green fluorescent protein / GFP Gene Plasmid Map 5609
H7N9 Nucleoprotein Gene Expression validated Image 14394
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.

Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein ORF mammalian expression plasmid, C-Flag tag Alternative Names

NP cDNA ORF Clone, H7N9

Nucleocapsid / NP Background Information

Influenza A viral nucleoprotein (NP) plays a critical role in virus replication and host adaptation.The influenza A virus nucleoprotein (NP) is an essential multifunctional protein that encapsidates the viral genome and functions as an adapter between the virus and the host cell machinery. NPs from all strains of influenza A viruses contain two nuclear localization signals (NLSs): a well-studied monopartite NLS1 and a less-characterized NLS2, thought to be bipartite.

Nucleocapsid / NP cDNA ORF Clone, H9N2, Related Products

Product Name Catalog#(PDF)
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized) VG40400-G
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized) VG40400-UT
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tag VG40400-ACG
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40400-ACGLN
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP ORF mammalian expression plasmid, N-GFPSpark tag VG40400-ANG
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40400-ACR
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40400-ANR
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-Flag tag VG40400-CF
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40400-NF
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40400-CH
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40400-NH
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40400-CY
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40400-NY
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40400-CM
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-Myc tag VG40400-NM

Nucleocapsid / NP cDNA ORF Clone, Influenza B, Related Products

Product Name Catalog#(PDF)
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized) VG40438-G
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized) VG40438-UT
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tag VG40438-ACG
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40438-ACGLN
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP ORF mammalian expression plasmid, N-GFPSpark tag VG40438-ANG
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40438-ACR
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40438-ANR
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-Flag tag VG40438-CF
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40438-NF
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40438-CH
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40438-NH
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40438-CY
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40438-NY
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40438-CM
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-Myc tag VG40438-NM

Nucleocapsid / NP cDNA ORF Clone, H10N8, Related Products

Product Name Catalog#(PDF)
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) VG40353-UT
Influenza A H10N8 (A/Jiangxi-Donghu/346/2013) Nucleocapsid / NP ORF mammalian expression plasmid (Codon Optimized) VG40362-G-N
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40353-ACGLN
Influenza A H10N8 (A/Jiangxi-Donghu/346/2013) Nucleocapsid / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40362-ACGLN

Nucleocapsid / NP cDNA ORF Clone, H5N8, Related Products

Product Name Catalog#(PDF)
Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014(Gochang1)) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized) VG40381-G-N
Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014(Gochang1)) Nucleocapsid protein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40381-ACGLN

Nucleocapsid / NP cDNA ORF Clone, H7N9, Related Products

Product Name Catalog#(PDF)
Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein ORF mammalian expression plasmid (Codon Optimized) VG40110-G-N
Influenza A H7N9 (A/Shanghai/1/2013) Nucleoprotein ORF mammalian expression plasmid (Codon Optimized) VG40111-G-N
Influenza A H7N9 (A/Shanghai/1/2013) Nucleoprotein (Codon Optimized) ORF mammalian expression plasmid, C-GFPSpark tag VG40111-ACG
Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein ORF mammalian expression plasmid, C-GFPSpark tag VG40110-ACG
Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40110-ACGLN
Influenza A H7N9 (A/Shanghai/1/2013) Nucleoprotein Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40111-ACGLN
Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein ORF mammalian expression plasmid, N-GFPSpark tag VG40110-ANG
Influenza A H7N9 (A/Shanghai/1/2013) Nucleoprotein (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40111-ACR
Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40110-ACR
Influenza A H7N9 (A/Shanghai/1/2013) Nucleoprotein (Codon Optimized) ORF mammalian expression plasmid, C-Flag tag VG40111-CF
Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40110-NF
Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein ORF mammalian expression plasmid, C-His tag VG40110-CH

Nucleocapsid / NP cDNA ORF Clone, H3N2, Related Products

Product Name Catalog#(PDF)
Influenza A H3N2 (A/Hong Kong/1/1968) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) VG40208-UT
Influenza A H3N2 (A/Memphis/1/68) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) VG40209-UT
Influenza A H3N2 (A/Aichi/2/1968) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) VG40207-UT
Influenza A H3N2 (A/Switzerland/9715293/2013) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) VG40499-UT
Influenza A H3N2 (A/Hong Kong/1/1968) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40208-ACGLN
Influenza A H3N2 (A/Switzerland/9715293/2013) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40499-ACGLN
Influenza A H3N2 (A/Memphis/1/68) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40209-ACGLN
Influenza A H3N2 (A/Aichi/2/1968) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40207-ACGLN

Nucleocapsid / NP cDNA ORF Clone, H7N7, Related Products

Product Name Catalog#(PDF)
Influenza A H7N7 (A/Netherlands/219/2003) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized) VG40210-G-N
Influenza A H7N7 (A/Netherlands/219/2003) Nucleocapsid protein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40210-ACGLN

Nucleocapsid / NP cDNA ORF Clone, H1N1, Related Products

Product Name Catalog#(PDF)
Influenza A H1N1 (A/Puerto Rico/8/1934) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) VG11675-UT
Influenza A H1N1 (A/Brevig Mission/1/1918) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) VG40204-UT
Influenza A H1N1 (A/USSR/90/1977) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) VG40206-UT
Influenza A H1N1 (A/California/07/2009) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) VG40205-UT
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) Nucleoprotein ORF mammalian expression plasmid, C-GFPSpark tag VG11675-ACG
Influenza A H1N1 (A/Brevig Mission/1/1918) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40204-ACGLN
Influenza A H1N1 (A/Puerto Rico/8/1934) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG11675-ACGLN
Influenza A H1N1 (A/California/07/2009) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40205-ACGLN
Influenza A H1N1 (A/USSR/90/1977) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40206-ACGLN
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) Nucleoprotein ORF mammalian expression plasmid, N-GFPSpark tag VG11675-ANG
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) Nucleoprotein ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG11675-ACR
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) Nucleoprotein ORF mammalian expression plasmid, C-Flag tag VG11675-CF
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) Nucleoprotein ORF mammalian expression plasmid, N-Flag tag VG11675-NF
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) Nucleoprotein ORF mammalian expression plasmid, C-His tag VG11675-CH
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) Nucleoprotein ORF mammalian expression plasmid, C-HA tag VG11675-CY
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) Nucleoprotein ORF mammalian expression plasmid, C-Myc tag VG11675-CM
info info
添加购物车成功! 添加购物车失败!