After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Influenza A H7N7 (A/Netherlands/219/2003) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized)

DatasheetReviewsRelated ProductsProtocols
H7N7 NP cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:1497bp
cDNA Description:Full length Clone DNA of Influenza A H7N7 (A/Netherlands/219/2003) Nucleocapsid protein DNA.
Gene Synonym:Nucleocapsid protein, NP
Restriction Site:KpnI + XbaI (5.5kb + 1.5kb)
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with Q6VE51.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
H7N7 NP Gene Plasmid Map
Influenza A H7N7 (A/Netherlands/219/2003) Nucleocapsid protein / NP Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Influenza A H7N7 (A/Netherlands/219/2003) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized) on other vectors
Product nameProduct name
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.