Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014(Gochang1)) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized)

Cat: VG40381-G-N
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Nucleocapsid / NP Reagents
CRO Services
Product recommended

All Nucleocapsid / NP Reagents
Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014(Gochang1)) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized) General Information
Gene
Species
H5N8
RefSeq ORF Size
1497 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AHL21420.1.
Description
Full length Clone DNA of Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014(Gochang1)) Nucleocapsid protein DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XbaI (5.5kb + 1.5kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Nucleocapsid / NP cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014(Gochang1)) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized) Validated Images
Human caspase-3 / CASP-3 Gene Plasmid Map 7169
Nucleocapsid / NP Background Information

Nucleocapsid / NP cDNA ORF Clone, Influenza B, Related Products

Product Name Catalog#(PDF)
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized) VG40438-G
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized) VG40438-UT
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40438-ACGLN
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tag VG40438-ACG
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP ORF mammalian expression plasmid, N-GFPSpark tag VG40438-ANG
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40438-ACR
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40438-ANR
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-Flag tag VG40438-CF
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40438-NF
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40438-CH
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40438-NH
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40438-CY
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40438-NY
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40438-CM
Influenza B (B/Florida/4/2006) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-Myc tag VG40438-NM

Nucleocapsid / NP cDNA ORF Clone, H9N2, Related Products

Product Name Catalog#(PDF)
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized) VG40400-G
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized) VG40400-UT
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tag VG40400-ACG
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40400-ACGLN
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP ORF mammalian expression plasmid, N-GFPSpark tag VG40400-ANG
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40400-ACR
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-OFPSpark / RFP tag VG40400-ANR
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-Flag tag VG40400-CF
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40400-NF
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-His tag VG40400-CH
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-His tag VG40400-NH
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-HA tag VG40400-CY
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-HA tag VG40400-NY
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, C-Myc tag VG40400-CM
Influenza A H9N2 (A/Hong Kong/2108/2003) Nucleocapsid protein / NP (Codon Optimized) ORF mammalian expression plasmid, N-Myc tag VG40400-NM

Nucleocapsid / NP cDNA ORF Clone, H3N2, Related Products

Product Name Catalog#(PDF)
Influenza A H3N2 (A/Switzerland/9715293/2013) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) VG40499-UT
Influenza A H3N2 (A/Aichi/2/1968) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) VG40207-UT
Influenza A H3N2 (A/Memphis/1/68) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) VG40209-UT
Influenza A H3N2 (A/Hong Kong/1/1968) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) VG40208-UT
Influenza A H3N2 (A/Hong Kong/1/1968) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40208-ACGLN
Influenza A H3N2 (A/Memphis/1/68) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40209-ACGLN
Influenza A H3N2 (A/Aichi/2/1968) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40207-ACGLN
Influenza A H3N2 (A/Switzerland/9715293/2013) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40499-ACGLN

Nucleocapsid / NP cDNA ORF Clone, H7N9, Related Products

Product Name Catalog#(PDF)
Influenza A H7N9 (A/Shanghai/1/2013) Nucleoprotein ORF mammalian expression plasmid (Codon Optimized) VG40111-G-N
Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein ORF mammalian expression plasmid (Codon Optimized) VG40110-G-N
Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40110-ACGLN
Influenza A H7N9 (A/Shanghai/1/2013) Nucleoprotein (Codon Optimized) ORF mammalian expression plasmid, C-GFPSpark tag VG40111-ACG
Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein ORF mammalian expression plasmid, C-GFPSpark tag VG40110-ACG
Influenza A H7N9 (A/Shanghai/1/2013) Nucleoprotein Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40111-ACGLN
Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein ORF mammalian expression plasmid, N-GFPSpark tag VG40110-ANG
Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40110-ACR
Influenza A H7N9 (A/Shanghai/1/2013) Nucleoprotein (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40111-ACR
Influenza A H7N9 (A/Shanghai/1/2013) Nucleoprotein (Codon Optimized) ORF mammalian expression plasmid, C-Flag tag VG40111-CF
Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein ORF mammalian expression plasmid, C-Flag tag VG40110-CF
Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40110-NF
Influenza A H7N9 (A/Anhui/1/2013) Nucleoprotein ORF mammalian expression plasmid, C-His tag VG40110-CH

Nucleocapsid / NP cDNA ORF Clone, H7N7, Related Products

Product Name Catalog#(PDF)
Influenza A H7N7 (A/Netherlands/219/2003) Nucleocapsid protein / NP ORF mammalian expression plasmid (Codon Optimized) VG40210-G-N
Influenza A H7N7 (A/Netherlands/219/2003) Nucleocapsid protein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40210-ACGLN

Nucleocapsid / NP cDNA ORF Clone, H10N8, Related Products

Product Name Catalog#(PDF)
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) VG40353-UT
Influenza A H10N8 (A/Jiangxi-Donghu/346/2013) Nucleocapsid / NP ORF mammalian expression plasmid (Codon Optimized) VG40362-G-N
Influenza A H10N8 (A/Jiangxi-Donghu/346/2013) Nucleocapsid / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40362-ACGLN
Influenza A H10N8 (A/duck/Guangdong/E1/2012) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40353-ACGLN

Nucleocapsid / NP cDNA ORF Clone, H1N1, Related Products

Product Name Catalog#(PDF)
Influenza A H1N1 (A/California/07/2009) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) VG40205-UT
Influenza A H1N1 (A/Puerto Rico/8/1934) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) VG11675-UT
Influenza A H1N1 (A/Brevig Mission/1/1918) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) VG40204-UT
Influenza A H1N1 (A/USSR/90/1977) Nucleoprotein / NP ORF mammalian expression plasmid (Codon Optimized) VG40206-UT
Influenza A H1N1 (A/Brevig Mission/1/1918) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40204-ACGLN
Influenza A H1N1 (A/Puerto Rico/8/1934) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG11675-ACGLN
Influenza A H1N1 (A/California/07/2009) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40205-ACGLN
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) Nucleoprotein ORF mammalian expression plasmid, C-GFPSpark tag VG11675-ACG
Influenza A H1N1 (A/USSR/90/1977) Nucleoprotein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40206-ACGLN
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) Nucleoprotein ORF mammalian expression plasmid, N-GFPSpark tag VG11675-ANG
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) Nucleoprotein ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG11675-ACR
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) Nucleoprotein ORF mammalian expression plasmid, C-Flag tag VG11675-CF
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) Nucleoprotein ORF mammalian expression plasmid, N-Flag tag VG11675-NF
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) Nucleoprotein ORF mammalian expression plasmid, C-His tag VG11675-CH
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) Nucleoprotein ORF mammalian expression plasmid, C-HA tag VG11675-CY
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) Nucleoprotein ORF mammalian expression plasmid, C-Myc tag VG11675-CM

Nucleocapsid / NP cDNA ORF Clone, H5N8, Related Products

Product Name Catalog#(PDF)
Influenza A H5N8 (A/breeder duck/Korea/Gochang1/2014(Gochang1)) Nucleocapsid protein / NP Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40381-ACGLN
info info
添加购物车成功! 添加购物车失败!