Quick Order

Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-His tag, expression ready

    DatasheetReviewsRelated ProductsProtocols
    H5N1 HA cDNA Clone Product Information
    NCBI RefSeq:
    RefSeq ORF Size:1701bp
    cDNA Description:Full length Clone DNA of Influenza A H5N1 (A/Xinjiang/1/2006) HA with N terminal His tag.
    Gene Synonym:HA1, Hemagglutinin
    Species:H5N1
    Vector:pCMV3-SP-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACJ68614.1.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-His tag, expression ready on other vectors
    Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-GFPSpark tag, expression readyVG40004-ACG$345
    Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40004-ACR$345
    Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin natural ORF mammalian expression plasmidVG40004-C$315
    Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-Flag tag, expression readyVG40004-CF$315
    Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-His tag, expression readyVG40004-CH$315
    Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-Myc tag, expression readyVG40004-CM$315
    Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, C-HA tag, expression readyVG40004-CY$315
    Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-Flag tag, expression readyVG40004-NF$315
    Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-His tag, expression readyVG40004-NH$315
    Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-Myc tag, expression readyVG40004-NM$315
    Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin ORF mammalian expression plasmid, N-HA tag, expression readyVG40004-NY$315
    Influenza A H5N1 (A/Xinjiang/1/2006) Hemagglutinin natural ORF mammalian expression plasmid, expression readyVG40004-UT$315
     Learn more about expression Vectors
    Product nameProduct name
    Background

    The influenza viral Hemagglutinin (HA) protein is a homo trimer with a receptor binding pocket on the globular head of each monomer.HA has at least 18 different antigens. These subtypes are named H1 through H18.HA has two functions. Firstly, it allows the recognition of target vertebrate cells, accomplished through the binding to these cells' sialic acid-containing receptors. Secondly, once bound it facilitates the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.The influenza virus Hemagglutinin (HA) protein is translated in cells as a single protein, HA0, or hemagglutinin precursor protein. For viral activation, hemagglutinin precursor protein (HA0) must be cleaved by a trypsin-like serine endoprotease at a specific site, normally coded for by a single basic amino acid (usually arginine) between the HA1 and HA2 domains of the protein. After cleavage, the two disulfide-bonded protein domains produce the mature form of the protein subunits as a prerequisite for the conformational change necessary for fusion and hence viral infectivity.

    References
  • White JM, Hoffman LR, Arevalo JH, et al. (1997). "Attachment and entry of influenza virus into host cells. Pivotal roles of hemagglutinin". In Chiu W, Burnett RM, Garcea RL. Structural Biology of Viruses.
  • Suzuki Y (March 2005). "Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses". Biol. Pharm. Bull. 28 (3): 399–408.
  • Senne DA, Panigrahy B, Kawaoka Y, et al. (1996). "Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential". Avian Dis. 40 (2): 425–37
  • Size / Price
    Catalog: VG40004-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"