Quick Order

Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag

DatasheetReviewsRelated ProductsProtocols
H5N1 HA cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:1704bp
cDNA Description:Full length Clone DNA of Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) HA with N terminal Flag tag.
Gene Synonym:HA1, Hemagglutinin
Species:H5N1
Vector:pCMV3-SP-N-FLAG
Plasmid:pCMV3-Flag-H5N1-JH-06-HA
Restriction Site:HindIII + NotI (6kb + 1.79kb)
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ABJ96775.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
H5N1 HA Gene Plasmid Map
Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin (Codon Optimized) natural ORF mammalian expression plasmid, N-Flag tag
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag on other vectors
Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG11694-ACG$345
Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG11694-ACR$345
Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11694-C$315
Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG11694-CF$315
Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG11694-CH$315
Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG11694-CM$315
Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG11694-CY$315
Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG11694-NF$315
Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG11694-NH$315
Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG11694-NM$315
Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG11694-NY$315
Influenza A H5N1 (A/Japanese white-eye/Hong Kong/1038/2006) Hemagglutinin ORF mammalian expression plasmid (Codon Optimized)VG11694-UT$315
 Learn more about expression Vectors
Product nameProduct name
Background

The influenza viral Hemagglutinin (HA) protein is a homo trimer with a receptor binding pocket on the globular head of each monomer.HA has at least 18 different antigens. These subtypes are named H1 through H18.HA has two functions. Firstly, it allows the recognition of target vertebrate cells, accomplished through the binding to these cells' sialic acid-containing receptors. Secondly, once bound it facilitates the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.The influenza virus Hemagglutinin (HA) protein is translated in cells as a single protein, HA0, or hemagglutinin precursor protein. For viral activation, hemagglutinin precursor protein (HA0) must be cleaved by a trypsin-like serine endoprotease at a specific site, normally coded for by a single basic amino acid (usually arginine) between the HA1 and HA2 domains of the protein. After cleavage, the two disulfide-bonded protein domains produce the mature form of the protein subunits as a prerequisite for the conformational change necessary for fusion and hence viral infectivity.

References
  • White JM, Hoffman LR, Arevalo JH, et al. (1997). "Attachment and entry of influenza virus into host cells. Pivotal roles of hemagglutinin". In Chiu W, Burnett RM, Garcea RL. Structural Biology of Viruses.
  • Suzuki Y (March 2005). "Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses". Biol. Pharm. Bull. 28 (3): 399–408.
  • Senne DA, Panigrahy B, Kawaoka Y, et al. (1996). "Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential". Avian Dis. 40 (2): 425–37
  • Size / Price
    Catalog: VG11694-NF
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"