Text Size:AAA

Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)

    DatasheetReviewsRelated ProductsProtocols
    H4N8 HA cDNA Clone Product Information
    NCBI RefSeq:
    RefSeq ORF Size:1695bp
    cDNA Description:Full length Clone DNA of Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin.
    Gene Synonym:Hemagglutinin, HA
    Restriction Site:
    Tag Sequence:
    Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with P19695.
    Sequencing primers:T7( 5' TAATACGACTCACTATAGGG 3' )
    Promoter:Enhanced CMV cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
    Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) on other vectors
    Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40025-ACG$345
    Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40025-ACR$345
    Influenza A H4N8 (A/chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40025-C$315
    Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40025-CF$315
    Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40025-CH$315
    Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40025-CM$315
    Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40025-CY$315
    Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40025-NF$315
    Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40025-NH$315
    Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40025-NM$315
    Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40025-NY$315
    Influenza A H4N8 (chicken/Alabama/1/1975) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40025-UT$315
     Learn more about expression Vectors
    Product nameProduct name

    The influenza viral Hemagglutinin (HA) protein is a homo trimer with a receptor binding pocket on the globular head of each monomer.HA has at least 18 different antigens. These subtypes are named H1 through H18.HA has two functions. Firstly, it allows the recognition of target vertebrate cells, accomplished through the binding to these cells' sialic acid-containing receptors. Secondly, once bound it facilitates the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.The influenza virus Hemagglutinin (HA) protein is translated in cells as a single protein, HA0, or hemagglutinin precursor protein. For viral activation, hemagglutinin precursor protein (HA0) must be cleaved by a trypsin-like serine endoprotease at a specific site, normally coded for by a single basic amino acid (usually arginine) between the HA1 and HA2 domains of the protein. After cleavage, the two disulfide-bonded protein domains produce the mature form of the protein subunits as a prerequisite for the conformational change necessary for fusion and hence viral infectivity.

  • White JM, Hoffman LR, Arevalo JH, et al. (1997). "Attachment and entry of influenza virus into host cells. Pivotal roles of hemagglutinin". In Chiu W, Burnett RM, Garcea RL. Structural Biology of Viruses.
  • Suzuki Y (March 2005). "Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses". Biol. Pharm. Bull. 28 (3): 399–408.
  • Senne DA, Panigrahy B, Kawaoka Y, et al. (1996). "Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential". Avian Dis. 40 (2): 425–37
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.