Influenza A H3N2 (A/Wisconsin/67/2005) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized)

Cat: VG40449-G-N
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Matrix protein 1 / M1 Reagents
CRO Services
Product recommended

All Matrix protein 1 / M1 Reagents
Influenza A H3N2 (A/Wisconsin/67/2005) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized) General Information
Gene
Species
H3N2
RefSeq ORF Size
759 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AHG97056.1.
Description
Full length Clone DNA of Influenza A H3N2 (A/Wisconsin/67/2005) Matrix protein 1 DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI (5.5kb + 0.76kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Matrix protein 1 / M1 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Influenza A H3N2 (A/Wisconsin/67/2005) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized) Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 7139
Matrix protein 1 / M1 Background Information
Full Name
cholinergic receptor, muscarinic 1

Matrix protein 1 / M1 cDNA ORF Clone, H1N1, Related Products

Product Name Catalog#(PDF)
Influenza A H1N1 (A/Brevig Mission/1/1918) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized) VG40211-UT
Influenza A H1N1 (A/California/07/2009) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized) VG40212-UT
Influenza A H1N1 (A/Puerto Rico/8/1934) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized) VG40010-UT
Influenza A H1N1 (A/New Caledonia/20/99) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized) VG40327-UT
Influenza A H1N1 (A/USSR/90/1977) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized) VG40213-UT
Influenza A H1N1 (A/USSR/90/1977) Matrix protein 1 / M1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40213-ACGLN
Influenza A H1N1 (A/California/07/2009) Matrix protein 1 / M1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40212-ACGLN
Influenza A H1N1 (A/Puerto Rico/8/1934) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized) VG40010-ACG
Influenza A H1N1 (A/Brevig Mission/1/1918) Matrix protein 1 / M1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40211-ACGLN
Influenza A H1N1 (A/New Caledonia/20/99) Matrix protein 1 / M1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40327-ACGLN
Influenza A H1N1 (A/Puerto Rico/8/1934) Matrix protein 1 / M1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40010-ACGLN

Matrix protein 1 / M1 cDNA ORF Clone, H2N2, Related Products

Product Name Catalog#(PDF)
Influenza A H2N2 (A/Japan/305/1957) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized) VG40214-UT
Influenza A H2N2 (A/Japan/305/1957) Matrix protein 1 / M1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40214-ACGLN
Influenza A H2N2 (A/Japan/305/1957) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized) VG40214-ACG

Matrix protein 1 / M1 cDNA ORF Clone, H7N7, Related Products

Product Name Catalog#(PDF)
Influenza A H7N7 (A/Netherlands/219/2003) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized) VG40217-UT
Influenza A H7N7 (A/Netherlands/219/2003) Matrix protein 1 / M1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40217-ACGLN
Influenza A H7N7 (A/Netherlands/219/2003) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized) VG40217-ACG

Matrix protein 1 / M1 cDNA ORF Clone, H3N2, Related Products

Product Name Catalog#(PDF)
Influenza A H3N2 (A/Hong Kong/1/1968) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized) VG40216-UT
Influenza A H3N2 (A/Aichi/2/1968) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized) VG40215-UT
Influenza A H3N2 (A/Wisconsin/67/2005) Matrix protein 1 / M1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40449-ACGLN
Influenza A H3N2 (A/Hong Kong/1/1968) Matrix protein 1 / M1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40216-ACGLN
Influenza A H3N2 (A/Aichi/2/1968) Matrix protein 1 / M1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40215-ACGLN

Matrix protein 1 / M1 cDNA ORF Clone, H7N9, Related Products

Product Name Catalog#(PDF)
Influenza A H7N9 (A/Anhui/1/2013) Matrix protein 1 ORF mammalian expression plasmid (Codon Optimized) VG40107-UT
Influenza A H7N9 (A/Anhui/1/2013) Matrix protein 1 ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark tag VG40107-ACG
Influenza A H7N9 (A/Anhui/1/2013) Matrix protein 1 Gene Lentiviral ORF cDNA expression plasmid, C-GFPSpark tag(Codon Optimized) VG40107-ACGLN
Influenza A H7N9 (A/Anhui/1/2013) Matrix protein 1(Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tag VG40107-ACR
Influenza A H7N9 (A/Anhui/1/2013) Matrix protein 1(Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark tag VG40107-CF
Influenza A H7N9 (A/Anhui/1/2013) Matrix protein 1 (Codon Optimized) ORF mammalian expression plasmid, N-Flag tag VG40107-NF
info info
添加购物车成功! 添加购物车失败!