Quick Order

Influenza A H3N2 (A/Wisconsin/67/2005) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized)

  • Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Matrix protein 1 / M1 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
H3N2 M1 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:759bp
cDNA Description:Full length Clone DNA of Influenza A H3N2 (A/Wisconsin/67/2005) Matrix protein 1 DNA.
Gene Synonym:Matrix protein 1, M1
Species:H3N2
Vector:pCMV/hygro
Plasmid:pCMV-H3N2-WI-05-M1
Restriction Site:KpnI + XhoI (5.5kb + 0.76kb)
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with AHG97056.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
H3N2 M1 Gene Plasmid Map
Influenza A H3N2 (A/Wisconsin/67/X-161/2005) Matrix protein 1 / M1 Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Influenza A H3N2 (A/Wisconsin/67/2005) Matrix protein 1 / M1 ORF mammalian expression plasmid (Codon Optimized) on other vectors
Product nameProduct name
Size / Price
Catalog: VG40449-G-N
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"