After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
H1N1 HA cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:1701bp
cDNA Description:Full length Clone DNA of Influenza A H1N1 (A/Ohio/07/2009) Hemagglutinin with N terminal His tag.
Gene Synonym:Hemagglutinin, HA
Species:H1N1
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with ACQ63286.1.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tag on other vectors
Influenza A H1N1 (A/Ohio/07/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-GFPSpark-taggedVG40007-ACG$345
Influenza A H1N1 (A/Ohio/07/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40007-ACR$345
Influenza A H1N1 (A/Ohio/07/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40007-C$315
Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), C-Flag tagVG40007-CF$315
Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-His tagVG40007-CH$315
Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-Myc tagVG40007-CM$315
Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, C-HA tagVG40007-CY$315
Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-Flag tagVG40007-NF$315
Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-His tagVG40007-NH$315
Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized), N-Myc-taggedVG40007-NM$315
Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA (Codon Optimized) ORF mammalian expression plasmid, N-HA tagVG40007-NY$315
Influenza A H1N1 (Ohio/07/2009) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)VG40007-UT$315
 Learn more about expression Vectors
Product nameProduct name
Size / Price
Catalog: VG40007-NH
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
Availability2-3 weeks
Bulk Discount InquiryAdd to Cart
Contact Us
Images
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"