Quick Order

Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
H1N1 NS1 cDNA Clone Product Information
NCBI RefSeq:AF389122.1
RefSeq ORF Size:693bp
cDNA Description:Full length Clone DNA of Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 with N terminal His tag.
Gene Synonym:NS1
Species:H1N1
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-His tag on other vectors
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, C-GFPSpark tagVG40011-ACG$325
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, C-OFPSpark / RFP tagVG40011-ACR$325
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-GFPSpark tagVG40011-ANG$325
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-OFPSpark / RFP tagVG40011-ANR$325
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, C-Flag tagVG40011-CF$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, C-His tagVG40011-CH$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, C-Myc tagVG40011-CM$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, C-HA tagVG40011-CY$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 natural ORF mammalian expression plasmidVG40011-M$95
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, His tagVG40011-M-H$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-Flag tagVG40011-NF$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-His tagVG40011-NH$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-Myc tagVG40011-NM$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 ORF mammalian expression plasmid, N-HA tagVG40011-NY$295
Influenza A H1N1 (A/Puerto Rico/8/34/Mount Sinai) NS1 natural ORF mammalian expression plasmidVG40011-UT$295
 Learn more about expression Vectors
Product nameProduct name
Background

The NS1 Influenza protein is created by the internal protein encoding, linear negative-sense, single stranded RNA, NS gene segment and which also codes for the nuclear export protein or NEP, formerly referred to as the NS2 protein, which mediates the export of vRNPs. The non-structural (NS1) protein is found in Influenza virus A, Influenza virus B and Influenza virus C. The non-structural (NS1) protein of the highly pathogenic avian H5N1 viruses circulating in poultry and waterfowl in Southeast Asia is currently believed to be responsible for the enhanced virulence of the strain. Non-structural (NS1) protein of influenza A viruses is a non-essential virulence factor that has multiple accessory functions during viral infection. The major role ascribed to NS1 has been its inhibition of host immune responses, especially the limitation of both interferon (IFN) production and the antiviral effects of IFN-induced proteins, such as dsRNA-dependent protein kinase R (PKR) and 2'5'-oligoadenylate synthetase (OAS)/RNase L. Non-structural (NS1) protein is a non-structural protein of the influenza A virus, which could only be expressed when cells are infected. The effect of NS1 protein on host cell is still not clear. Not only could NS1 remarkably affect metabolism, but it could also slow down cell proliferation through blocking cell cycle. Non-structural (NS1) protein may lead to the development of novel antiviral drugs, and the use of oncolytic influenza A viruses as potential anti-cancer agents.

References
  • Enami,M. et al., 1997, Nippon Rinsho. 55 (10):2605-9.
  • Bergmann,M. et al., 2000, J Virol. 74 (13):6203-6.
  • Hale,B.G. et al., 2008, J Gen Virol. 89 (Pt 10):2359-76.
  • Zhao,L. et al., 2008, Sheng Wu Gong Cheng Xue Bao. 24 (11):1912-7
  • Size / Price
    Catalog: VG40011-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"