Quick Order

Text Size:AAA

Influenza A H11N2 (A/thick-billed murre/Newfoundland/031/2007) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized)

DatasheetReviewsRelated ProductsProtocols
H11N2 HA cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:1698bp
cDNA Description:Full length Clone DNA of Influenza A H11N2 (A/thick-billed murre/Newfoundland/031/2007) Hemagglutinin DNA.
Gene Synonym:Hemagglutinin, HA
Restriction Site:HindIII + XbaI (5.5kb + 1.7kb)
Tag Sequence:
Sequence Description:A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with D9D738.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
H11N2 HA Gene Plasmid Map
Influenza A H11N2 (A/thick-billed murre/Newfoundland/031/2007) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Influenza A H11N2 (A/thick-billed murre/Newfoundland/031/2007) Hemagglutinin / HA ORF mammalian expression plasmid (Codon Optimized) on other vectors
Product nameProduct name

The influenza viral Hemagglutinin (HA) protein is a homo trimer with a receptor binding pocket on the globular head of each monomer.HA has at least 18 different antigens. These subtypes are named H1 through H18.HA has two functions. Firstly, it allows the recognition of target vertebrate cells, accomplished through the binding to these cells' sialic acid-containing receptors. Secondly, once bound it facilitates the entry of the viral genome into the target cells by causing the fusion of host endosomal membrane with the viral membrane.The influenza virus Hemagglutinin (HA) protein is translated in cells as a single protein, HA0, or hemagglutinin precursor protein. For viral activation, hemagglutinin precursor protein (HA0) must be cleaved by a trypsin-like serine endoprotease at a specific site, normally coded for by a single basic amino acid (usually arginine) between the HA1 and HA2 domains of the protein. After cleavage, the two disulfide-bonded protein domains produce the mature form of the protein subunits as a prerequisite for the conformational change necessary for fusion and hence viral infectivity.

  • White JM, Hoffman LR, Arevalo JH, et al. (1997). "Attachment and entry of influenza virus into host cells. Pivotal roles of hemagglutinin". In Chiu W, Burnett RM, Garcea RL. Structural Biology of Viruses.
  • Suzuki Y (March 2005). "Sialobiology of influenza: molecular mechanism of host range variation of influenza viruses". Biol. Pharm. Bull. 28 (3): 399–408.
  • Senne DA, Panigrahy B, Kawaoka Y, et al. (1996). "Survey of the hemagglutinin (HA) cleavage site sequence of H5 and H7 avian influenza viruses: amino acid sequence at the HA cleavage site as a marker of pathogenicity potential". Avian Dis. 40 (2): 425–37
  • Size / Price
    Catalog: VG40187-G-N
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    • Influenza A H11N2 (A/thick-billed murre/Newfoundland/031/2007) Hemagglutinin / HA Gene cDNA Clone (Codon Optimized, full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.