After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human ITK Kinase Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human ITK cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human ITK Gene Plasmid Map
Human ITK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

IL-2-inducible T cell kinase is a member of the protein kinase superfamily, Tyr protein kinase family and TEC subfamily. It contains 1 Btk-type zinc finger, 1 PH domain, 1 protein kinase domain, 1 SH2 domain and 1 SH3 domain. As an intracellular kinase which expressed in T-cells, IL-2-inducible T cell kinase contains both SH2 and SH3 domains which are often found in intracellular kinases. It is hought to play a role in T-cell proliferation and differentiation. It regulates the development, function and differentiation of conventional T-cells and nonconventional NKT-cells. IL-2-inducible T cell kinase also plays an essential role in regulation of the adaptive immune response. efects in IL-2-inducible T cell kinase are the cause of lymphoproliferative syndrome EBV-associated autosomal type 1 (LPSA1). LPSA1 is a rare immunodeficiency characterized by extreme susceptibility to infection with Epstein-Barr virus (EBV). Inadequate immune response to EBV can have a fatal outcome. Clinical features include splenomegaly, lymphadenopathy, anemia, thrombocytopenia, pancytopenia, recurrent infections. There is an increased risk for lymphoma.

  • Lee SH, et al. (2011) The association of a single-nucleotide polymorphism of the IL-2 inducible T-cell Kinase gene with asthma. Ann Hum Genet. 75(3):359-69.
  • Yao HL, et al. (2010) Effect of Itk down regulation on cytokines production in Jurkat cell. Zhonghua Shi Yan He Lin Chuang Bing Du Xue Za Zhi. 24(5):358-61.
  • Pechloff K, et al. (2010) The fusion kinase ITK-SYK mimics a T cell receptor signal and drives oncogenesis in conditional mouse models of peripheral T cell lymphoma. J Exp Med. 207(5):1031-44.
  • Contact Us
    • Human ITK Kinase Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.