Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, untagged

Cat: HG11849-G-N

This product is not available, please contact order@sinobiological.com for relevant product if required.

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Integrin alpha 4/CD49d/ITGA4 Reagents
CRO Services

All Integrin alpha 4/CD49d/ITGA4 Reagents
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
834 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
HindIII + XhoI (5.5kb + 0.83kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, untagged Validated Images
Human MMP2/MMP-2/CLG4A Gene Plasmid Map 7152
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, untagged Alternative Names
CD49D cDNA ORF Clone, Human;IA4 cDNA ORF Clone, Human
Integrin alpha 4/CD49d/ITGA4 Background Information
Full Name
integrin, alpha 4 (antigen CD49D, alpha 4 subunit of VLA-4 receptor)
Research Areas

Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone in Cloning Vector, Rhesus CG90193-G
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, untagged CG90193-UT
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90193-ACG
Integrin alpha 4/CD49d/ITGA4 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90193-ACGLN
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90193-ACR
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90193-CF
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90193-NF
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, C-His tag CG90193-CH
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, N-His tag CG90193-NH
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, C-HA tag CG90193-CY
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, N-HA tag CG90193-NY
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, C-Myc tag CG90193-CM
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rhesus, N-Myc tag CG90193-NM

Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone in Cloning Vector, Rat RG80291-G
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, untagged RG80291-UT
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80291-ACG
Integrin alpha 4/CD49d/ITGA4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80291-ACGLN
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80291-ACR
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80291-CF
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80291-NF
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, C-His tag RG80291-CH
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, N-His tag RG80291-NH
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, C-HA tag RG80291-CY
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, N-HA tag RG80291-NY
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, C-Myc tag RG80291-CM
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Rat, N-Myc tag RG80291-NM
Integrin alpha 4/CD49d/ITGA4 qPCR Primer Pairs, Rat RP300268

Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone in Cloning Vector, Mouse MG50049-M
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, untagged MG50049-UT
Integrin alpha 4/CD49d/ITGA4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50049-ACGLN
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50049-ACG
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50049-ACR
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50049-CF
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50049-NF
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, C-His tag MG50049-CH
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, N-His tag MG50049-NH
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, C-HA tag MG50049-CY
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, N-HA tag MG50049-NY
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, C-Myc tag MG50049-CM
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Mouse, N-Myc tag MG50049-NM
Integrin alpha 4/CD49d/ITGA4 qPCR Primer Pairs, Mouse MP200049

Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone in Cloning Vector, Human HG12121-M
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, untagged HG12121-UT
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, C-GFPSpark® tag HG12121-ACG
Integrin alpha 4/CD49d/ITGA4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11849-ACGLN
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, C-OFPSpark® tag HG12121-ACR
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12121-CF
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12121-NF
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, C-His tag HG12121-CH
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, N-His tag HG12121-NH
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, C-HA tag HG12121-CY
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, N-HA tag HG12121-NY
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, C-Myc tag HG12121-CM
Integrin alpha 4/CD49d/ITGA4 cDNA ORF Clone, Human, N-Myc tag HG12121-NM
Integrin alpha 4/CD49d/ITGA4 qPCR Primer Pairs, Human HP101648
info info
添加购物车成功! 添加购物车失败!