Our new search engine has been launched. Welcome to use it and experience it. If you have any suggestions, welcome to contact us!
Text Size:AAA

Human ITGA2 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human ITGA2 cDNA Clone Product Information
NCBI RefSeq:NM_002203.3
RefSeq ORF Size:3546bp
cDNA Description:Full length Clone DNA of Homo sapiens integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor).
Gene Synonym:BR, GPIa, CD49B, VLA-2, VLAA2, ITGA2
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-ITGA2
Restriction Site:KpnI + XbaI (5.5kb + 3.55kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for three point mutations: 759 C/T, 825 G/A and 3252 C/T not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human ITGA2 Gene Plasmid Map
Human ITGA2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Size / Price
Catalog: HG13024-M-N
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Human ITGA2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"