Text Size:AAA

Human ITGA2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ITGA2cDNA Clone Product Information
Gene Bank Ref.ID:NM_002203.3
cDNA Size:3546
cDNA Description:ORF Clone of Homo sapiens integrin, alpha 2 (CD49B, alpha 2 subunit of VLA-2 receptor) DNA.
Gene Synonym:BR, GPIa, CD49B, VLA-2, VLAA2, ITGA2
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XbaI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for three point mutations: 759 C/T, 825 G/A and 3252 C/T not causing the amino acid variation.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Related Products
Product nameProduct name
Catalog:HG13024-M-N
List Price: $545.00  (Save $0.00)
Price:$545.00      [How to order]
Availability5 business days
Images
  • Human ITGA2 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"