In observance of Chinese Independence Day, we will not be able to arrange any shipment from October 1st to October 6th due to the closure of Chinese Customs offices.
Text Size:AAA

Human IRAK4 ORF mammalian expression plasmid, Flag tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IRAK4cDNA Clone Product Information
RefSeq ORF Size:1383bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin-1 receptor-associated kinase 4 with Flag tag.
Gene Synonym:IPD1, REN64, NY-REN-64, IRAK4
Restriction Site:KpnI + XhoI (5.4kb + 1.43kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Other IRAK4 Protein Products
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Related Products
Product nameProduct name

Interleukin-1 receptor-associated kinase 4, also known as Renal carcinoma antigen NY-REN-64, IRAK-4 and IRAK4, is a member of the protein kinase superfamily, TKL Ser/Thr protein kinase family and Pelle subfamily. IRAK4 contains one death domain and one protein kinase domain. IRAK4 is required for the efficient recruitment of IRAK1 to the IL-1 receptor complex following IL-1 engagement, triggering intracellular signaling cascades leading to transcriptional up-regulation and mRNA stabilization. It also phosphorylates IRAK1. A member of the IL-1 receptor (IL-1R)-associated kinase (IRAK) family, IRAK4, has been shown to play an essential role in Toll-like receptor (TLR)-mediated signaling. IL-1-mediated IRAK4 kinase activity in T cells is essential for induction of IL-23R expression, Th17 differentiation, and autoimmune disease. Pharmacological blocking of IRAK4 kinase activity will retain some levels of host defence, while reducing the levels and duration of inflammatory responses, which should provide beneficial therapies for sepsis and chronic inflammatory diseases. Defects in IRAK4 are the cause of recurrent isolated invasive pneumococcal disease type 1 (IPD1) which is defined as two episodes of IPD occurring at least 1 month apart, whether caused by the same or different serotypes or strains. Recurrent IPD occurs in at least 2% of patients in most series, making IPD the most important known risk factor for subsequent IPD. Defects in IRAK4 are also the cause of IRAK4 deficiency which causes extracellular pyogenic bacterial and fungal infections in otherwise healthy children.

  • Strelow,A. et al., 2003, FEBS Lett. 547 (1-3):157-61.
  • Kim,T.W. et al., 2007, J Exp Med. 204 (5):1025-36.
  • Trumstedt,C. et al., 2007, J Leukoc Biol. 81 (6):1591-8.
  • Li,X. et al., 2008, Eur J Immunol. 38 (3):614-8.
  • Staschke,K.A. et al., 2009, J Immunol. 183 (1): 568-77.