| NCBI RefSeq: | NM_000207.2 |
| RefSeq ORF Size: | 333bp |
| cDNA Description: | Full length Clone DNA of Homo sapiens insulin. |
| Gene Synonym: | ILPR, IRDN, INS |
| Species: | Human |
| Vector: | pCMV/hygro |
| Plasmid: | pCMV-INS |
| Restriction Site: | KpnI + XhoI (5.5kb + 0.33kb) |
| Tag Sequence: | |
| Sequence Description: | Identical with the Gene Bank Ref. ID sequence.
|
| Sequencing primers: | T7(TAATACGACTCACTATAGGG)
BGH(TAGAAGGCACAGTCGAGG) |
| Promoter: | Enhanced CMV mammalian cell promoter |
| Application: | Stable or Transient mammalian expression |
| Antibiotic in E.coli: | Ampicilin |
| Antibiotic in mammalian cell: | Hygromycin |
| Shipping_carrier: | Each tube contains lyophilized plasmid. |
| Storage: | The lyophilized plasmid can be stored at room temperature for three months. |
After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us！
