Quick Order

Human Insulin / INS Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Human INS cDNA Clone Product Information
    NCBI RefSeq:NM_000207.2
    RefSeq ORF Size:333bp
    cDNA Description:Full length Clone DNA of Homo sapiens insulin.
    Gene Synonym:ILPR, IRDN, INS
    Species:Human
    Vector:pCMV/hygro
    Plasmid:pCMV-INS
    Restriction Site:KpnI + XhoI (5.5kb + 0.33kb)
    Tag Sequence:
    Sequence Description:Identical with the Gene Bank Ref. ID sequence.
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with INS qPCR primers for gene expression analysis, HP100995 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    pCMV/hygro Vector Information
     
    Vector Name pCMV/hygro
    Vector Size 5657bp
    Vector Type Mammalian Expression Vector
    Expression Method Constiutive ,Stable / Transient
    Promoter CMV
    Antibiotic Resistance Ampicillin
    Selection In Mammalian Cells Hygromycin
    Protein Tag None
    Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
    Reverse:BGH(TAGAAGGCACAGTCGAGG)


    Schematic of pCMV/hygro Multiple Cloning Sites
    Product nameProduct name
    Background

    After removal of the precursor signal peptide, proinsulin is post-translationally cleaved into three peptides: the B chain and A chain peptides, which are covalently linked via two disulfide bonds to form insulin, and C-peptide. Binding of insulin to the insulin receptor (INSR) stimulates glucose uptake.

    Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

    References
  • Veedfald S, Plamboeck A, Deacon C F, et al. Cephalic phase secretion of insulin and other enteropancreatic hormones in humans[J]. American Journal of Physiology-Gastrointestinal and Liver Physiology, 2016, 310(1): G43-G51.
  • Size / Price
    Catalog: HG11038-M-N
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"