Text Size:AAA

Human IL6 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL6cDNA Clone Product Information
Gene Bank Ref.ID:NM_000600.2
cDNA Size:639
cDNA Description:ORF Clone of Homo sapiens interleukin 6 (interferon, beta 2) DNA.
Gene Synonym:HGF, HSF, BSF2, IL-6, IFNB2, IL6
Species:Human
Vector:pCMV/hygro-His
Restriction Site:KpnI + XhoI
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref.ID sequence.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)
pCMV/hygro-HIs Physical Map

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

IL-6 Family & Receptor Related Products
Product nameProduct name
Human IL6ST / gp130 / CD130 Protein (His & Fc Tag)Human IL6ST / gp130 / CD130 ProteinMouse LIF Protein (Fc Tag)Mouse LIF Protein (His Tag)Human CNTF Protein (His Tag)Human GM-CSF / CSF2 Protein (Fc Tag)Human G-CSF / CSF3 Protein (Fc Tag)Human NNT1 / CLCF1 / CLC Protein (Fc Tag)Canine IL11RA / IL-11RA / IL11Rα ProteinRat CNTF / Ciliary Neurotrophic Factor ProteinRat CNTFR / CNTFR-alpha Protein (His Tag)Rat GM-CSF / CSF2 Protein (Fc Tag)Rat GM-CSF / CSF2 Protein (His Tag)Rat gp130 / IL6ST / CD130 Protein (His & Fc Tag)Rat gp130 / IL6ST / CD130 Protein (His Tag)Human CNTFR / CNTFR-alpha Protein (His Tag)Mouse Oncostatin M / OSM Protein (His Tag)Human Leptin ProteinHuman LIF Protein (His Tag)Rat IL6 / Interleukin-6 ProteinHuman LIF Protein (Fc Tag)Mouse Oncostatin M / OSM ProteinMouse CNTF / Ciliary Neurotrophic Factor Protein (His Tag)Human GM-CSF / CSF2 ProteinMouse IL11RA / IL11Rα Protein (His Tag)Human GM-CSF / CSF2 Protein (His Tag)Human GM-CSF / CSF2 ProteinHuman Oncostatin M / OSM Protein (His Tag)Mouse IL6 / Interleukin-6 ProteinRat LIFR Protein (His Tag)Human LIFR / CD118 Protein (His Tag)Human G-CSFR / CD114 / CSF3R Protein (Fc Tag)Human G-CSFR / CD114 Protein (His Tag)Human G-CSFR / CD114 / CSF3R ProteinHuman G-CSF / CSF3 Protein (isoform b)Human Oncostatin M / OSM ProteinCynomolgus / Rhesus IL6 / Interleukin-6 ProteinHuman IL11RA / IL11Rα Protein (His Tag)Mouse IL6ST / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His & Fc Tag)Mouse IL6ST / gp130 / CD130 Protein (His Tag)Mouse IL-31 / IL31 Protein (His Tag)Rat IL-6R / CD126 Protein (ECD, His Tag)Canine IL11RA / IL-11RA / IL11Rα Protein (His Tag)Human IL6 / Interleukin-6 ProteinHuman IL-31 / IL31 Protein (His Tag)Human G-CSF / CSF3 Protein (isoform b)Human CSF2RA / GM-CSFR / CD116 Protein (His Tag)Human CSF2RA / GM-CSFR / CD116 Protein (Fc Tag)Mouse GM-CSF / CSF2 ProteinHuman Leptin Receptor / LEPR / CD295 Protein (His & Fc Tag)Human Leptin Receptor / LEPR / CD295 Protein (His Tag)Human LIF ProteinCynomolgus IL6ST / gp130 Protein (Fc Tag)Cynomolgus IL6ST / gp130 Protein (His Tag)Mouse IL6RA / CD126 Protein (His Tag)Mouse GM-CSF / CSF2 Protein (Fc Tag)Mouse GM-CSF / CSF2 Protein (His Tag)Human IL11 / Interleukin 11 / IL-11 ProteinHuman OSMR / IL31RB Protein (His Tag)Human IL6R / CD126 Protein (His Tag)Mouse LIFR / CD118 Protein (His Tag)Mouse OSMR / IL-31RB Protein (His Tag)
Background

Interleukin-6 (IL-6) is a multifunctional α-helical cytokine that regulates cell growth and differentiation of various tissues, which is known particularly for its role in the immune response and acute phase reactions. IL-6 protein is secreted by a variety of cell types including T cells and macrophages as phosphorylated and variably glycosylated molecule. It exerts actions through the its heterodimeric receptor composed of IL-6R that lacks the tyrosine/kinase domain and binds IL-6 with low affinity, and ubiquitously expressed glycoprotein 130 (gp130) that binds the IL-6. IL-6R complex with high affinity and thus transduces signals. IL-6 is also involved in hematopoiesis, bone metabolism, and cancer progression, and has been defined an essential role in directing transition from innate to acquired immunity.

References
  • Heinrich PC. et al. (2003). Principles of interleukin-6-type cytokine signalling and its regulation. Biochem J. 374: 1-20.
  • Rose-John S, et al. (2007) The IL-6/sIL-6R complex as a novel target for therapeutic approaches. Expert Opin Ther Targets. 11(5): 613-24.
  • Dinh W, et al. (2009) Elevated plasma levels of TNF-alpha and interleukin-6 in patients with diastolic dysfunction and glucose metabolism disorders. Cardiovasc Diabetol. 8:58.
  • Catalog:HG10395-M-H
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human IL6 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"