Text Size:AAA

Human IL5Ra transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL5RAcDNA Clone Product Information
Gene Bank Ref.ID:NM_000564.3
cDNA Size:1263
cDNA Description:ORF Clone of Homo sapiens interleukin 5 receptor, alpha (IL5RA), transcript variant 1 DNA.
Gene Synonym:IL5R, CD125, CDw125, HSIL5R3, MGC26560, IL5RA
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Whatman FTA elute card (Cat: WB120410) contains 5-10 μg of plasmid.
Storage:The Whatman FTA elute card can be stored at room temperature for three months under dry condition.
Image
Human IL5Ra transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

pCMV/hygro vector information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Other Interleukin & Receptor Related Products
Product nameProduct name
Human IL7RA / CD127 Protein (His & Fc Tag)Human IL7RA / CD127 Protein (His Tag)Mouse IL16 / Interleukin-16 Protein (His Tag)Human IL2Ra / CD25 Protein (Fc Tag)Human IL2Ra / CD25 Protein (His Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Rat IL9 / IL-9 Protein (His Tag)Human IL3RA / CD123 Protein (His & Fc Tag)Human IL3RA / CD123 Protein (His Tag)Canine IL3RA Protein (His Tag)Canine IL13RA2 / IL13R Protein (Fc Tag)Canine IL13RA2 / IL13R Protein (His Tag)Canine IL2RB / IL2 Receptor beta Protein (Fc Tag)Mouse IL-34 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His & Fc Tag)Mouse IL13RA2 / CD213A2 Protein (His Tag)Human IL2RG / CD132 Protein (Fc Tag)Human IL2RG / CD132 Protein (His Tag)Rat Interleukin-2 / IL-2 ProteinRat IL7R / IL7RA Protein (Fc Tag)Rat IL7R / IL7RA Protein (His Tag)Rat IL13RA1 Protein (Fc Tag) Rat IL-21R / Interleukin-21 Receptor Protein (His Tag)Mouse IL2RG Protein (His & Fc Tag)Mouse IL2RG / CD132 Protein (His Tag)Mouse IL-13Ra1 Protein (His & Fc Tag)Rat IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (His Tag)Rat IL4R / Il4ra Protein (Fc Tag)Rat IL4R / Il4ra Protein (His Tag)Rat IL13RA2 / IL13R Protein (Fc Tag)Rat IL13RA2 / IL13R Protein (His Tag)Rat IL3 / interleukin 3 Protein (His Tag)Mouse IL13RA1 Protein (His Tag)Mouse IL7RA / CD127 Protein (His Tag)Rat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Cynomolgus IL13 / ALRH Protein (His Tag)Cynomolgus IL13 / ALRH ProteinHuman Interleukin-32 / IL-32 Protein (isoform alpha, His Tag)Human IL5 / Interleukin 5 ProteinHuman CD122 / IL-2RB Protein (Fc Tag)Human CD122 / IL-2RB ProteinCynomolgus IL-21R / Interleukin-21 Receptor Protein (His Tag)Human IL-3 / Interleukin-3 Protein (His Tag)Mouse CD122 / IL2RB / IL2 Receptor beta Protein (His Tag)Mouse IL13 / ALRH ProteinMouse IL4 / Interleukin-4 ProteinCynomolgus / Rhesus IL21R / IL-21R Protein (Fc Tag)Human IL3 / IL-3 ProteinHuman IL2 / Interleukin-2 Protein (L35M, L36S, C142A)Cynomolgus IL2RA Protein (Fc Tag)Cynomolgus IL2RA Protein (His Tag)Cynomolgus IL2RA ProteinCynomolgus IL-8 / CXCL8 ProteinMouse IL2RA / CD25 Protein (His Tag)Human IL13RA2 / IL13R Protein (His & Fc Tag)Human IL-9 / Interleukin-9 Protein (His Tag)Human IL4 / Interleukin-4 ProteinHuman Interleukin-2 / IL-2 ProteinHuman IL-15 / IL15 / Interleukin 15 Protein (His Tag)Mouse Interleukin-2 / IL-2 ProteinMouse IL5 Protein (His Tag)Human IL13 / ALRH Protein (Fc Tag)Human IL13 / ALRH ProteinMouse IL4 / Interleukin-4 Protein (Q136D, Y139D, His Tag)Mouse IL5Ra / CD125 Protein (His Tag)Human IL5Ra / CD125 Protein (His Tag)Human IL-21R / Interleukin-21 Receptor Protein (His Tag)Human IL4R / CD124 Protein (His Tag)Canine IL-8 / CXCL8 ProteinCanine Interleukin-2 / IL-2 Protein (147 Cys/Ser)Canine IL5 Protein (His Tag)Canine IL4 / Interleukin-4 ProteinHuman IL-8 / CXCL8 Protein (aa 1-77, Fc Tag)Human IL-8 / CXCL8 Protein (aa 6-77, Fc Tag)Human IL-8 / CXCL8 Protein (aa 1-77)Human IL-8 / CXCL8 Protein (aa 6-77)Human IL13RA1 Protein (His & Fc Tag)Human IL13RA1 Protein (His Tag)Human IL16 / Interleukin-16 Protein (His Tag)