Text Size:AAA

Human IL5Ra transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL5RAcDNA Clone Product Information
Gene Bank Ref.ID:NM_000564.3
cDNA Size:1263
cDNA Description:ORF Clone of Homo sapiens interleukin 5 receptor, alpha (IL5RA), transcript variant 1 DNA.
Gene Synonym:IL5R, CD125, CDw125, HSIL5R3, MGC26560, IL5RA
Species:Human
Vector:pCMV/hygro
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Other Interleukin & Receptor Related Products
Product nameProduct name
Human IL7RA / CD127 Protein (His & Fc Tag)Human IL7RA / CD127 Protein (His Tag)Mouse IL16 / Interleukin-16 Protein (His Tag)Human IL3 / IL-3 Protein (His Tag)Cynomolgus IL2RA ProteinHuman IL4 / Interleukin-4 ProteinHuman IL2Ra / CD25 Protein (Fc Tag)Human IL2Ra / CD25 Protein (His Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Rat IL9 / IL-9 Protein (His Tag)Human IL3RA / CD123 Protein (His & Fc Tag)Human IL3RA / CD123 Protein (His Tag)Canine IL3RA Protein (His Tag)Canine IL13RA2 / IL13R Protein (Fc Tag)Canine IL13RA2 / IL13R Protein (His Tag)Canine IL2RB / IL2 Receptor beta Protein (Fc Tag)Mouse IL-34 Protein (His Tag)Cynomolgus IL13 / ALRH Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Human IL-3 / Interleukin-3 Protein (His Tag)Canine IL4 / Interleukin-4 ProteinMouse IL5 Protein (His Tag)Canine IL5 Protein (His Tag)Human IL-9 / Interleukin-9 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His & Fc Tag)Mouse IL13RA2 / CD213A2 Protein (His Tag)Mouse IL13 / ALRH ProteinHuman IL2RG / CD132 Protein (Fc Tag)Human IL2RG / CD132 Protein (His Tag)Rat Interleukin-2 / IL-2 ProteinRat IL7R / IL7RA Protein (Fc Tag)Rat IL7R / IL7RA Protein (His Tag)Mouse IL4 / Interleukin-4 ProteinRat IL13RA1 Protein (Fc Tag) Rat IL-21R / Interleukin-21 Receptor Protein (His Tag)Mouse IL2RG Protein (His & Fc Tag)Mouse IL2RG / CD132 Protein (His Tag)Mouse IL-13Ra1 Protein (His & Fc Tag)Rat IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (His Tag)Rat IL4R / Il4ra Protein (Fc Tag)Rat IL4R / Il4ra Protein (His Tag)Rat IL13RA2 / IL13R Protein (Fc Tag)Rat IL13RA2 / IL13R Protein (His Tag)Rat IL3 / interleukin 3 Protein (His Tag)Mouse IL13RA1 Protein (His Tag)Mouse IL7RA / CD127 Protein (His Tag)Mouse CD123 / IL3RA Protein (ECD, His Tag)Rat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Cynomolgus CD127 / IL-7RA Protein (His Tag)Human IL5 / Interleukin 5 ProteinHuman IL13 / ALRH ProteinHuman IL3 / IL-3 ProteinCynomolgus IL13 / ALRH ProteinHuman CD122 / IL-2RB ProteinMouse IL-4R / CD124 Protein (ECD, His Tag)Mouse CD122 / IL2RB / IL2 Receptor beta Protein (His Tag)Human Interleukin-32 / IL-32 Protein (isoform alpha, His Tag)Human IL13RA1 Protein (His Tag)Human CD122 / IL-2RB Protein (Fc Tag)Cynomolgus IL-21R / Interleukin-21 Receptor Protein (His Tag)Cynomolgus / Rhesus IL21R / IL-21R Protein (Fc Tag)Human IL2 / Interleukin-2 Protein (L35M, L36S, C142A)Cynomolgus IL2RA Protein (Fc Tag)Cynomolgus IL2RA Protein (His Tag)Cynomolgus IL-8 / CXCL8 ProteinMouse IL2RA / CD25 Protein (His Tag)Human IL13RA2 / IL13R Protein (His & Fc Tag)Human Interleukin-2 / IL-2 ProteinHuman IL-15 / IL15 / Interleukin 15 Protein (His Tag)Mouse Interleukin-2 / IL-2 ProteinMouse IL4 / Interleukin-4 Protein (Q136D, Y139D, His Tag)Human IL13 / ALRH Protein (Fc Tag)Mouse IL5Ra / CD125 Protein (His Tag)Human IL5Ra / CD125 Protein (His Tag)Human IL-21R / Interleukin-21 Receptor Protein (His Tag)Human IL4R / CD124 Protein (His Tag)Canine IL-8 / CXCL8 ProteinCanine Interleukin-2 / IL-2 Protein (147 Cys/Ser)Human IL-8 / CXCL8 Protein (aa 23-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 23-99)Human IL-8 / CXCL8 Protein (aa 28-99)Human IL16 / Interleukin-16 Protein (His Tag)Human IL13RA1 Protein (His & Fc Tag)
Background

Interleukin 5 receptor, alpha (IL5RA) also known as CD125 (Cluster of Differentiation 125) is a subunit of the Interleukin-5 receptor. IL5RA (CD125) is an interleukin 5 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL5 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL5. This protein has been found to interact with syndecan binding protein (syntenin), which is required for IL5 mediated activation of the transcription factor SOX4. Six alternatively spliced transcript variants encoding three distinct isoforms have been reported. IL5RA (CD125) is a T-cell-derived cytokine which is particularly important in the development of asthma for the lerminal differentiation, activation and survival of committed cosinophil precursors.

References
  • Isobe M, et al. (1992) Localization of the gene encoding the alpha subunit of human interleukin-5 receptor (IL5RA) to chromosome region 3p24-3p26. Genomics. 14(3): 755-8.
  • Cheong HS, et al. (2005) Association analysis of interleukin 5 receptor alpha subunit (IL5RA) polymorphisms and asthma. J Hum Genet. 50(12): 628-34.
  • Isobe M, et al. (1992) Localization of the gene encoding the alpha subunit of human interleukin-5 receptor (IL5RA) to chromosome region 3p24-3p26. Genomics. 14(3): 755-8.
  • Catalog:HG10391-M-N
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human IL5Ra transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"