IL5RA cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10391-M-F
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL5RA Reagents
CRO Services

All IL5RA Reagents
IL5RA cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1263 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 5 receptor, alpha (IL5RA), transcript variant 1 DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
IL5RA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL5RA cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human IL5RA (CD125) Gene Plasmid Map 7260
IL5RA cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CD125 cDNA ORF Clone, Human;CDw125 cDNA ORF Clone, Human;HSIL5R3 cDNA ORF Clone, Human;IL5R cDNA ORF Clone, Human
IL5RA Background Information

Interleukin 5 receptor, alpha (IL5RA) also known as CD125 (Cluster of Differentiation 125) is a subunit of the Interleukin-5 receptor. IL5RA (CD125) is an interleukin 5 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL5 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL5. This protein has been found to interact with syndecan binding protein (syntenin), which is required for IL5 mediated activation of the transcription factor SOX4. Six alternatively spliced transcript variants encoding three distinct isoforms have been reported. IL5RA (CD125) is a T-cell-derived cytokine which is particularly important in the development of asthma for the lerminal differentiation, activation and survival of committed cosinophil precursors.

Full Name
interleukin 5 receptor, alpha
References
  • Isobe M, et al. (1992) Localization of the gene encoding the alpha subunit of human interleukin-5 receptor (IL5RA) to chromosome region 3p24-3p26. Genomics. 14(3): 755-8.
  • Cheong HS, et al. (2005) Association analysis of interleukin 5 receptor alpha subunit (IL5RA) polymorphisms and asthma. J Hum Genet. 50(12): 628-34.
  • Isobe M, et al. (1992) Localization of the gene encoding the alpha subunit of human interleukin-5 receptor (IL5RA) to chromosome region 3p24-3p26. Genomics. 14(3): 755-8.
  • IL5RA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL5RA cDNA ORF Clone in Cloning Vector, Human HG10392-M
    IL5RA cDNA ORF Clone in Cloning Vector, Human HG10391-M
    IL5RA cDNA ORF Clone, Human, untagged HG10392-UT
    IL5RA cDNA ORF Clone, Human, untagged HG10391-UT
    IL5RA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10392-ACGLN
    IL5RA cDNA ORF Clone, Human, C-GFPSpark® tag HG10391-ACG
    IL5RA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10391-ACGLN
    IL5RA cDNA ORF Clone, Human, C-GFPSpark® tag HG10392-ACG
    IL5RA cDNA ORF Clone, Human, C-OFPSpark® tag HG10391-ACR
    IL5RA cDNA ORF Clone, Human, C-OFPSpark® tag HG10392-ACR
    IL5RA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10392-CF
    IL5RA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10391-CF
    IL5RA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10391-NF
    IL5RA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10392-NF
    IL5RA cDNA ORF Clone, Human, C-His tag HG10392-CH
    IL5RA cDNA ORF Clone, Human, C-His tag HG10391-CH
    IL5RA cDNA ORF Clone, Human, N-His tag HG10391-NH
    IL5RA cDNA ORF Clone, Human, N-His tag HG10392-NH
    IL5RA cDNA ORF Clone, Human, C-HA tag HG10392-CY
    IL5RA cDNA ORF Clone, Human, C-HA tag HG10391-CY
    IL5RA cDNA ORF Clone, Human, N-HA tag HG10391-NY
    IL5RA cDNA ORF Clone, Human, N-HA tag HG10392-NY
    IL5RA cDNA ORF Clone, Human, C-Myc tag HG10392-CM
    IL5RA cDNA ORF Clone, Human, C-Myc tag HG10391-CM
    IL5RA cDNA ORF Clone, Human, N-Myc tag HG10392-NM
    IL5RA cDNA ORF Clone, Human, N-Myc tag HG10391-NM
    IL5RA qPCR Primer Pairs, Human HP100424
    info info
    添加购物车成功! 添加购物车失败!