Text Size:AAA

Human IL5Ra transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL5RAcDNA Clone Product Information
Gene Bank Ref.ID:NM_000564.3
cDNA Size:1263
cDNA Description:ORF Clone of Homo sapiens interleukin 5 receptor, alpha (IL5RA), transcript variant 1 DNA.
Gene Synonym:IL5R, CD125, CDw125, HSIL5R3, MGC26560, IL5RA
Species:Human
Vector:pCMV/hygro-FLAG
Restriction Site:KpnI + XhoI
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Whatman FTA elute card (Cat: WB120410) contains 5-10 μg of plasmid.
Storage:The Whatman FTA elute card can be stored at room temperature for three months under dry condition.
Image
Human IL5Ra transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

pCMV/hygro-FLAG vector information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV/hygro-FLAG Physical Map
Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG tag info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Other Interleukin & Receptor Related Products
Product nameProduct name
Human IL7RA / CD127 Protein (His & Fc Tag)Human IL7RA / CD127 Protein (His Tag)Mouse IL16 / Interleukin-16 Protein (His Tag)Human IL2Ra / CD25 Protein (Fc Tag)Human IL2Ra / CD25 Protein (His Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Rat IL9 / IL-9 Protein (His Tag)Human IL3RA / CD123 Protein (His & Fc Tag)Human IL3RA / CD123 Protein (His Tag)Canine IL3RA Protein (His Tag)Canine IL13RA2 / IL13R Protein (Fc Tag)Canine IL13RA2 / IL13R Protein (His Tag)Canine IL2RB / IL2 Receptor beta Protein (Fc Tag)Mouse IL-34 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His & Fc Tag)Mouse IL13RA2 / CD213A2 Protein (His Tag)Human IL2RG / CD132 Protein (Fc Tag)Human IL2RG / CD132 Protein (His Tag)Rat Interleukin-2 / IL-2 ProteinRat IL7R / IL7RA Protein (Fc Tag)Rat IL7R / IL7RA Protein (His Tag)Rat IL13RA1 Protein (Fc Tag) Rat IL-21R / Interleukin-21 Receptor Protein (His Tag)Mouse IL2RG Protein (His & Fc Tag)Mouse IL2RG / CD132 Protein (His Tag)Mouse IL-13Ra1 Protein (His & Fc Tag)Rat IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (His Tag)Rat IL4R / Il4ra Protein (Fc Tag)Rat IL4R / Il4ra Protein (His Tag)Rat IL13RA2 / IL13R Protein (Fc Tag)Rat IL13RA2 / IL13R Protein (His Tag)Rat IL3 / interleukin 3 Protein (His Tag)Mouse IL13RA1 Protein (His Tag)Mouse IL7RA / CD127 Protein (His Tag)Rat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Cynomolgus IL13 / ALRH Protein (His Tag)Cynomolgus IL13 / ALRH ProteinHuman Interleukin-32 / IL-32 Protein (isoform alpha, His Tag)Human IL5 / Interleukin 5 ProteinHuman CD122 / IL-2RB Protein (Fc Tag)Human CD122 / IL-2RB ProteinCynomolgus IL-21R / Interleukin-21 Receptor Protein (His Tag)Human IL-3 / Interleukin-3 Protein (His Tag)Mouse CD122 / IL2RB / IL2 Receptor beta Protein (His Tag)Mouse IL13 / ALRH ProteinMouse IL4 / Interleukin-4 ProteinCynomolgus / Rhesus IL21R / IL-21R Protein (Fc Tag)Human IL3 / IL-3 ProteinHuman IL2 / Interleukin-2 Protein (L35M, L36S, C142A)Cynomolgus IL2RA Protein (Fc Tag)Cynomolgus IL2RA Protein (His Tag)Cynomolgus IL2RA ProteinCynomolgus IL-8 / CXCL8 ProteinMouse IL2RA / CD25 Protein (His Tag)Human IL13RA2 / IL13R Protein (His & Fc Tag)Human IL-9 / Interleukin-9 Protein (His Tag)Human IL4 / Interleukin-4 ProteinHuman Interleukin-2 / IL-2 ProteinHuman IL-15 / IL15 / Interleukin 15 Protein (His Tag)Mouse Interleukin-2 / IL-2 ProteinMouse IL5 Protein (His Tag)Human IL13 / ALRH Protein (Fc Tag)Human IL13 / ALRH ProteinMouse IL4 / Interleukin-4 Protein (Q136D, Y139D, His Tag)Mouse IL5Ra / CD125 Protein (His Tag)Human IL5Ra / CD125 Protein (His Tag)Human IL-21R / Interleukin-21 Receptor Protein (His Tag)Human IL4R / CD124 Protein (His Tag)Canine IL-8 / CXCL8 ProteinCanine Interleukin-2 / IL-2 Protein (147 Cys/Ser)Canine IL5 Protein (His Tag)Canine IL4 / Interleukin-4 ProteinHuman IL-8 / CXCL8 Protein (aa 1-77, Fc Tag)Human IL-8 / CXCL8 Protein (aa 6-77, Fc Tag)Human IL-8 / CXCL8 Protein (aa 1-77)Human IL-8 / CXCL8 Protein (aa 6-77)Human IL13RA1 Protein (His & Fc Tag)Human IL13RA1 Protein (His Tag)Human IL16 / Interleukin-16 Protein (His Tag)
Background

Interleukin 5 receptor, alpha (IL5RA) also known as CD125 (Cluster of Differentiation 125) is a subunit of the Interleukin-5 receptor. IL5RA (CD125) is an interleukin 5 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL5 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL5. This protein has been found to interact with syndecan binding protein (syntenin), which is required for IL5 mediated activation of the transcription factor SOX4. Six alternatively spliced transcript variants encoding three distinct isoforms have been reported. IL5RA (CD125) is a T-cell-derived cytokine which is particularly important in the development of asthma for the lerminal differentiation, activation and survival of committed cosinophil precursors.

References
  • Isobe M, et al. (1992) Localization of the gene encoding the alpha subunit of human interleukin-5 receptor (IL5RA) to chromosome region 3p24-3p26. Genomics. 14(3): 755-8.
  • Cheong HS, et al. (2005) Association analysis of interleukin 5 receptor alpha subunit (IL5RA) polymorphisms and asthma. J Hum Genet. 50(12): 628-34.
  • Isobe M, et al. (1992) Localization of the gene encoding the alpha subunit of human interleukin-5 receptor (IL5RA) to chromosome region 3p24-3p26. Genomics. 14(3): 755-8.
  • Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"