After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

DatasheetReviewsRelated ProductsProtocols
Human IL1F5 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:
Vector:
Restriction Site:
Tag Sequence:
Sequence Description:
Shipping_carrier:
Storage:
Human IL1F5 Gene Plasmid Map
Human IL36RN / IL1F5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Interleukin-1 family member 5 (IL-1F5), also known as interleukin 36 receptor antagonist (IL36RA), is a member of the interleukin 1 cytokine family. This cytokine was shown to specifically inhibit the activation of NF-kappaB induced by interleukin 1 family, member 6 (IL1F6). IL-1F5 is a highly and a specific antagonist of the IL-1 receptor-related protein 2-mediated response to interleukin 1 family member 9 (IL1F9). IL-1F5 could constitute part of an independent signaling system analogous to interleukin-1 alpha (IL-1A), beta (IL-1B) receptor agonist and interleukin-1 receptor type I (IL-1R1), which is present in epithelial barriers and takes part in local inflammatory response. It has been proved that IL-1F5 induces IL-4 mRNA and protein expression in glia in vitro and enhances hippocampal expression of IL-4 following intracerebroventricular injection. The inhibitory effect of IL-1F5 on LPS-induced IL-1β is attenuated in cells from IL-4-defective mice. Experiment results suggest that IL-1F5 mediates anti-inflammatory effects through its ability to induce IL-4 production and that this is a consequence of its interaction with the orphan receptor, single Ig IL-1R-related molecule (SIGIRR)/TIR8, as the effects were not observed in SIGIRR−/− mice. In contrast to its effects in brain tissue, IL-1F5 did not attenuate LPS-induced changes, or up-regulated IL-4 in macrophages or dendritic cells, suggesting that the effect is confined to the brain.

References
  • Nicklin MJ, et al. (1994) A physical map of the region encompassing the human interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist genes. Genomics. 19 (2): 382-4.
  • Debets R, et al. (2001) Two novel IL-1 family members, IL-1 delta and IL-1 epsilon, function as an antagonist and agonist of NF-kappa B activation through the orphan IL-1 receptor-related protein 2. J Immunol. 167 (3): 1440-6.
  • Costelloe C, et al. (2008) IL-1F5 mediates anti-inflammatory activity in the brain through induction of IL-4 following interaction with SIGIRR/TIR8. J Neurochem. 105(5): 1960-9.
  •  

    Images
    • Human IL36RN / IL1F5 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"