IL36RN cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10125-M-F

This product is not available, please contact order@sinobiological.com for relevant product if required.

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IL36RN Reagents
CRO Services

All IL36RN Reagents
IL36RN cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
468 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 1 family, member 5 (delta), transcript variant 1 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI (5.5kb + 0.5kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
IL36RN cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL36RN cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human G-CSF/CSF3 Gene Plasmid Map 7153
IL36RN cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
FIL1 cDNA ORF Clone, Human;FIL1(DELTA) cDNA ORF Clone, Human;FIL1D cDNA ORF Clone, Human;IL-36Ra cDNA ORF Clone, Human;IL1F5 cDNA ORF Clone, Human;IL1HY1 cDNA ORF Clone, Human;IL1L1 cDNA ORF Clone, Human;IL1RP3 cDNA ORF Clone, Human;IL36RA cDNA ORF Clone, Human;IL36RN cDNA ORF Clone, Human;PSORP cDNA ORF Clone, Human;PSORS14 cDNA ORF Clone, Human
IL36RN Background Information

Interleukin-1 family member 5 (IL-1F5), also known as interleukin 36 receptor antagonist (IL36RA), is a member of the interleukin 1 cytokine family. This cytokine was shown to specifically inhibit the activation of NF-kappaB induced by interleukin 1 family, member 6 (IL1F6). IL-1F5 is a highly and a specific antagonist of the IL-1 receptor-related protein 2-mediated response to interleukin 1 family member 9 (IL1F9). IL-1F5 could constitute part of an independent signaling system analogous to interleukin-1 alpha (IL-1A), beta (IL-1B) receptor agonist and interleukin-1 receptor type I (IL-1R1), which is present in epithelial barriers and takes part in local inflammatory response. It has been proved that IL-1F5 induces IL-4 mRNA and protein expression in glia in vitro and enhances hippocampal expression of IL-4 following intracerebroventricular injection. The inhibitory effect of IL-1F5 on LPS-induced IL-1β is attenuated in cells from IL-4-defective mice. Experiment results suggest that IL-1F5 mediates anti-inflammatory effects through its ability to induce IL-4 production and that this is a consequence of its interaction with the orphan receptor, single Ig IL-1R-related molecule (SIGIRR)/TIR8, as the effects were not observed in SIGIRR−/− mice. In contrast to its effects in brain tissue, IL-1F5 did not attenuate LPS-induced changes, or up-regulated IL-4 in macrophages or dendritic cells, suggesting that the effect is confined to the brain.

Full Name
interleukin 36 receptor antagonist
References
  • Nicklin MJ, et al. (1994) A physical map of the region encompassing the human interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist genes. Genomics. 19 (2): 382-4.
  • Debets R, et al. (2001) Two novel IL-1 family members, IL-1 delta and IL-1 epsilon, function as an antagonist and agonist of NF-kappa B activation through the orphan IL-1 receptor-related protein 2. J Immunol. 167 (3): 1440-6.
  • Costelloe C, et al. (2008) IL-1F5 mediates anti-inflammatory activity in the brain through induction of IL-4 following interaction with SIGIRR/TIR8. J Neurochem. 105(5): 1960-9.
  • IL36RN cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL36RN cDNA ORF Clone in Cloning Vector, Mouse MG50213-M
    IL36RN cDNA ORF Clone, Mouse, untagged MG50213-UT
    IL36RN Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50213-ACGLN
    IL36RN cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50213-ACG
    IL36RN cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50213-ACR
    IL36RN cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50213-CF
    IL36RN cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50213-NF
    IL36RN cDNA ORF Clone, Mouse, C-His tag MG50213-CH
    IL36RN cDNA ORF Clone, Mouse, N-His tag MG50213-NH
    IL36RN cDNA ORF Clone, Mouse, C-HA tag MG50213-CY
    IL36RN cDNA ORF Clone, Mouse, N-HA tag MG50213-NY
    IL36RN cDNA ORF Clone, Mouse, C-Myc tag MG50213-CM
    IL36RN cDNA ORF Clone, Mouse, N-Myc tag MG50213-NM
    IL36RN qPCR Primer Pairs, Mouse MP200241

    IL36RN cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL36RN cDNA ORF Clone in Cloning Vector, Human HG10125-M
    IL36RN cDNA ORF Clone, Human, untagged HG10125-UT
    IL36RN Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10125-ACGLN
    IL36RN cDNA ORF Clone, Human, C-GFPSpark® tag HG10125-ACG
    IL36RN cDNA ORF Clone, Human, C-OFPSpark® tag HG10125-ACR
    IL36RN cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10125-CF
    IL36RN cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10125-NF
    IL36RN cDNA ORF Clone, Human, C-His tag HG10125-CH
    IL36RN cDNA ORF Clone, Human, N-His tag HG10125-NH
    IL36RN cDNA ORF Clone, Human, C-HA tag HG10125-CY
    IL36RN cDNA ORF Clone, Human, N-HA tag HG10125-NY
    IL36RN cDNA ORF Clone, Human, C-Myc tag HG10125-CM
    IL36RN cDNA ORF Clone, Human, N-Myc tag HG10125-NM
    IL36RN qPCR Primer Pairs, Human HP100198
    info info
    添加购物车成功! 添加购物车失败!