IL-33 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG50118-M-F
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IL-33 Reagents
CRO Services

All IL-33 Reagents
IL-33 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
801 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse interleukin 33 DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
HindIII + XhoI
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
IL-33 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL-33 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images
Mouse IL-33 Gene Expression validated Image 2477
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Human 4E-BP1/EIF4EBP1 Gene Plasmid Map 7162
IL-33 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
9230117N10Rik cDNA ORF Clone, Mouse;Il-33 cDNA ORF Clone, Mouse;Il1f11 cDNA ORF Clone, Mouse;NF-HEV cDNA ORF Clone, Mouse
IL-33 Background Information

Interleukin 33 (IL-33), also known as DVS27 or NF-HEV (Nuclear Factor from High Endothelial enules), is a proinflammatory protein and a chromatin-associated cytokine of the IL-1 family with high sequence and structural similarity to IL-1 and IL-18. IL-33 protein is expressed highly and rather selectively by high endothelial venule endothelial cells (HEVECs) in human tonsils, Peyers's patches, and lymph nodes. IL-33 protein has transcriptional regulatory properties, and the researches suggested that IL-33 is a dual-function protein that might act both as a cytokine and as an intracellular nuclear factor. As a type 2 cytokines, IL-33 protein also play a pivotal role in helminthic infection and allergic disorders.

Full Name
interleukin 33
References
  • Iikura M, et al. (2007) IL-33 can promote survival, adhesion and cytokine production in human mast cells. Lab Invest. 87(10): 971-8.
  • Lamkanfi M, et al. (2009) IL-33 raises alarm. Immunity. 31(1): 5-7.
  • IL-33 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IL-33 cDNA ORF Clone in Cloning Vector, Canine DG70005-G
    IL-33 cDNA ORF Clone, Canine, untagged DG70005-UT
    IL-33 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70005-ACG
    IL-33 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70005-ACGLN
    IL-33 cDNA ORF Clone, Canine, N-GFPSpark® tag DG70005-ANG
    IL-33 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70005-ACR
    IL-33 cDNA ORF Clone, Canine, N-OFPSpark® tag DG70005-ANR
    IL-33 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70005-CF
    IL-33 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70005-NF
    IL-33 cDNA ORF Clone, Canine, C-His tag DG70005-CH
    IL-33 cDNA ORF Clone, Canine, N-His tag DG70005-NH
    IL-33 cDNA ORF Clone, Canine, C-HA tag DG70005-CY
    IL-33 cDNA ORF Clone, Canine, N-HA tag DG70005-NY
    IL-33 cDNA ORF Clone, Canine, C-Myc tag DG70005-CM
    IL-33 cDNA ORF Clone, Canine, N-Myc tag DG70005-NM

    IL-33 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL-33 cDNA ORF Clone in Cloning Vector, Rat RG80011-G
    IL-33 cDNA ORF Clone, Rat, untagged RG80011-UT
    IL-33 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80011-ACG
    IL-33 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80011-ACGLN
    IL-33 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80011-ACR
    IL-33 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80011-CF
    IL-33 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80011-NF
    IL-33 cDNA ORF Clone, Rat, C-His tag RG80011-CH
    IL-33 cDNA ORF Clone, Rat, N-His tag RG80011-NH
    IL-33 cDNA ORF Clone, Rat, C-HA tag RG80011-CY
    IL-33 cDNA ORF Clone, Rat, N-HA tag RG80011-NY
    IL-33 cDNA ORF Clone, Rat, C-Myc tag RG80011-CM
    IL-33 cDNA ORF Clone, Rat, N-Myc tag RG80011-NM
    IL-33 qPCR Primer Pairs, Rat RP300010

    IL-33 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL-33 cDNA ORF Clone in Cloning Vector, Mouse MG50118-M
    IL-33 cDNA ORF Clone, Mouse, untagged MG50118-UT
    IL-33 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50118-ACGLN
    IL-33 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50118-ACG
    IL-33 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50118-ANG
    IL-33 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50118-ACR
    IL-33 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50118-CF
    IL-33 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50118-NF
    IL-33 cDNA ORF Clone, Mouse, C-His tag MG50118-CH
    IL-33 cDNA ORF Clone, Mouse, N-His tag MG50118-NH
    IL-33 cDNA ORF Clone, Mouse, C-HA tag MG50118-CY
    IL-33 cDNA ORF Clone, Mouse, N-HA tag MG50118-NY
    IL-33 cDNA ORF Clone, Mouse, C-Myc tag MG50118-CM
    IL-33 cDNA ORF Clone, Mouse, N-Myc tag MG50118-NM
    IL-33 qPCR Primer Pairs, Mouse MP200148

    IL-33 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL-33 cDNA ORF Clone in Cloning Vector, Human HG10368-M
    IL-33 cDNA ORF Clone, Human, untagged HG10368-UT
    IL-33 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10368-ACGLN
    IL-33 cDNA ORF Clone, Human, C-GFPSpark® tag HG10368-ACG
    IL-33 cDNA ORF Clone, Human, N-GFPSpark® tag HG10368-ANG
    IL-33 cDNA ORF Clone, Human, C-OFPSpark® tag HG10368-ACR
    IL-33 cDNA ORF Clone, Human, N-OFPSpark® tag HG10368-ANR
    IL-33 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10368-CF
    IL-33 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10368-NF
    IL-33 cDNA ORF Clone, Human, C-His tag HG10368-CH
    IL-33 cDNA ORF Clone, Human, N-His tag HG10368-NH
    IL-33 cDNA ORF Clone, Human, C-HA tag HG10368-CY
    IL-33 cDNA ORF Clone, Human, N-HA tag HG10368-NY
    IL-33 cDNA ORF Clone, Human, C-Myc tag HG10368-CM
    IL-33 cDNA ORF Clone, Human, N-Myc tag HG10368-NM
    IL-33 qPCR Primer Pairs, Human HP100403
    info info
    添加购物车成功! 添加购物车失败!