Text Size:AAA

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL2RGcDNA Clone Product Information
cDNA Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Other Interleukin & Receptor Related Products
Product nameProduct name
Mouse CD122 / IL2RB / IL2 Receptor beta Protein (His Tag)Canine IL3RA Protein (His Tag)Canine IL2RB / IL2 Receptor beta Protein (Fc Tag)Human IL-15 / IL15 / Interleukin 15 Protein (His Tag)Mouse CD123 / IL3RA Protein (ECD, Fc Tag)Human IL3 / IL-3 Protein (His Tag)Cynomolgus / Rhesus IL21R / IL-21R Protein (Fc Tag)Human IL3 / IL-3 ProteinMouse IL-21R / Il21R Protein (ECD, His Tag)Rat IL9 / IL-9 Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Human IL-8 / CXCL8 Protein (aa 23-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 23-99)Human IL-8 / CXCL8 Protein (aa 28-99)Human IL2Ra / CD25 Protein (Fc Tag)Human IL2Ra / CD25 Protein (His Tag)Human IL13RA2 / IL13R Protein (His & Fc Tag)Human IL13RA2 / CD213A2 Protein (His Tag)Human IL13 / ALRH Protein (Fc Tag)Human IL13 / ALRH ProteinHuman IL5Ra / CD125 Protein (His Tag)Human IL4R / CD124 Protein (His Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Human IL3RA / CD123 Protein (His & Fc Tag)Human IL3RA / CD123 Protein (His Tag)Mouse CD123 / IL3RA Protein (ECD, His Tag)Human IL2RG / CD132 Protein (Fc Tag)Human IL2RG / CD132 Protein (His Tag)Human CD122 / IL-2RB Protein (Fc Tag)Human CD122 / IL-2RB ProteinHuman IL13RA1 Protein (His & Fc Tag)Human IL13RA1 Protein (His Tag)Human IL16 / Interleukin-16 Protein (His Tag)Human IL7RA / CD127 Protein (His & Fc Tag)Cynomolgus CD127 / IL-7RA Protein (His Tag)Human IL7RA / CD127 Protein (His Tag)Cynomolgus IL13 / ALRH Protein (His Tag)Cynomolgus IL13 / ALRH ProteinHuman Interleukin-32 / IL-32 Protein (isoform alpha, His Tag)Human IL-21R / Interleukin-21 Receptor Protein (His Tag)Human IL-9 / Interleukin-9 Protein (His Tag)Human IL4 / Interleukin-4 ProteinHuman Interleukin-2 / IL-2 ProteinHuman IL-3 / Interleukin-3 Protein (His Tag)Mouse IL-4R / CD124 Protein (ECD, His Tag)Mouse IL4 / Interleukin-4 ProteinMouse IL-34 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His & Fc Tag)Mouse IL13RA2 / CD213A2 Protein (His Tag)Mouse IL2RG Protein (His & Fc Tag)Mouse IL2RG / CD132 Protein (His Tag)Mouse IL-13Ra1 Protein (His & Fc Tag)Mouse IL13RA1 Protein (His Tag)Mouse IL7RA / CD127 Protein (His Tag)Mouse IL13 / ALRH ProteinMouse IL2RA / CD25 Protein (His Tag)Mouse Interleukin-2 / IL-2 ProteinMouse IL5 Protein (His Tag)Mouse IL4 / Interleukin-4 Protein (Q136D, Y139D, His Tag)Mouse IL5Ra / CD125 Protein (His Tag)Canine IL-8 / CXCL8 ProteinCanine Interleukin-2 / IL-2 Protein (147 Cys/Ser)Canine IL5 Protein (His Tag)Canine IL4 / Interleukin-4 ProteinCanine IL13RA2 / IL13R Protein (His Tag)Human IL5 / Interleukin 5 ProteinRat Interleukin-2 / IL-2 ProteinRat IL7R / IL7RA Protein (Fc Tag)Rat IL7R / IL7RA Protein (His Tag)Rat IL13RA1 Protein (Fc Tag) Rat IL-21R / Interleukin-21 Receptor Protein (His Tag)Rat IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (His Tag)Rat IL4R / Il4ra Protein (Fc Tag)Rat IL4R / Il4ra Protein (His Tag)Rat IL13RA2 / IL13R Protein (Fc Tag)Rat IL13RA2 / IL13R Protein (His Tag)Rat IL3 / interleukin 3 Protein (His Tag)Rat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Human IL2 / Interleukin-2 Protein (L35M, L36S, C142A)Cynomolgus IL-21R / Interleukin-21 Receptor Protein (His Tag)Cynomolgus IL2RA Protein (Fc Tag)Cynomolgus IL2RA Protein (His Tag)Cynomolgus IL2RA ProteinCynomolgus IL-8 / CXCL8 ProteinMouse IL16 / Interleukin-16 Protein (His Tag)Canine IL13RA2 / IL13R Protein (Fc Tag)

The common gamma chain (γc) (or CD132), also known as interleukin-2 receptor subunit gamma or IL2RG, is a member of the type I cytokine receptor family expressed on most lymphocyte (white blood cell) populations, and its gene is found on the X-chromosome of mammals. The common gamma chain (γc) (or IL2RG), is a cytokine receptor sub-unit that is common to the receptor complexes for at least six different interleukin receptors: IL-2, IL-4, IL-7, IL-9, IL-15 and interleukin-21 receptor. It is a component of multiple cytokine receptors that are essential for lymphocyte development and function. X-linked severe combined immunodeficiency (XSCID) is a rare and potentially fatal disease caused by mutations of IL2RG, the gene encoding IL2RG. IL2RG was demonstrated to be a component of the IL-4 receptor on the basis of chemical cross-linking data, the ability of IL2RG to augment IL-4 binding affinity. The observation that IL-2R gamma is a functional component of the IL-4 receptor, together with the finding that IL-2R gamma associates with the IL-7 receptor, begins to elucidate why deficiency of this common gamma chain (gamma c) has a profound effect on lymphoid function and development, as seen in X-linked severe combined immunodeficiency.

  • Russell SM, et al. (1993) Interleukin-2 receptor gamma chain: a functional component of the interleukin-4 receptor. Science. 262 (5141): 1880-3.
  • Miyazaki T, et al. (1994) Functional activation of Jak1 and Jak3 by selective association with IL-2 receptor subunits. Science. 266 (5187): 1045-7.
  • Takeshita T, et al. (1992) Cloning of the gamma chain of the human IL-2 receptor. Science. 257 (5068): 379-82.
  • Size / Price
    • Human IL2Rg Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items