Text Size:AAA

Human IL2RG Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL2RGcDNA Clone Product Information
Gene Bank Ref.ID:NM_000206.1
cDNA Size:1110
cDNA Description:ORF Clone of Homo sapiens interleukin 2 receptor, gamma (severe combined immunodeficiency) DNA.
Gene Synonym:IMD4, CD132, SCIDX, SCIDX1
Species:Human
Vector:pCMV/hygro-FLAG
Restriction Site:KpnI + XhoI
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro-FLAG Vector Information
 
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV/hygro-FLAG Physical Map
Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Other Interleukin & Receptor Related Products
Product nameProduct name
Human IL7RA / CD127 Protein (His & Fc Tag)Human IL7RA / CD127 Protein (His Tag)Mouse IL16 / Interleukin-16 Protein (His Tag)Cynomolgus IL2RA ProteinHuman IL4 / Interleukin-4 ProteinHuman IL2Ra / CD25 Protein (Fc Tag)Human IL2Ra / CD25 Protein (His Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Rat IL9 / IL-9 Protein (His Tag)Human IL3RA / CD123 Protein (His & Fc Tag)Human IL3RA / CD123 Protein (His Tag)Canine IL3RA Protein (His Tag)Canine IL13RA2 / IL13R Protein (Fc Tag)Canine IL13RA2 / IL13R Protein (His Tag)Canine IL2RB / IL2 Receptor beta Protein (Fc Tag)Mouse IL-34 Protein (His Tag)Cynomolgus IL13 / ALRH Protein (His Tag)Human IL-8 / CXCL8 ProteinHuman IL-3 / Interleukin-3 Protein (His Tag)Canine IL4 / Interleukin-4 ProteinMouse IL5 Protein (His Tag)Canine IL5 Protein (His Tag)Human IL-9 / Interleukin-9 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His & Fc Tag)Mouse IL13RA2 / CD213A2 Protein (His Tag)Mouse IL13 / ALRH ProteinHuman IL2RG / CD132 Protein (Fc Tag)Human IL2RG / CD132 Protein (His Tag)Rat Interleukin-2 / IL-2 ProteinRat IL7R / IL7RA Protein (Fc Tag)Rat IL7R / IL7RA Protein (His Tag)Mouse IL4 / Interleukin-4 ProteinRat IL13RA1 Protein (Fc Tag) Rat IL-21R / Interleukin-21 Receptor Protein (His Tag)Mouse IL2RG Protein (His & Fc Tag)Mouse IL2RG / CD132 Protein (His Tag)Mouse IL-13Ra1 Protein (His & Fc Tag)Rat IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (His Tag)Rat IL4R / Il4ra Protein (Fc Tag)Rat IL4R / Il4ra Protein (His Tag)Rat IL13RA2 / IL13R Protein (Fc Tag)Rat IL13RA2 / IL13R Protein (His Tag)Rat IL3 / interleukin 3 Protein (His Tag)Mouse IL13RA1 Protein (His Tag)Mouse IL7RA / CD127 Protein (His Tag)Mouse CD123 / IL3RA Protein (ECD, His Tag)Rat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Cynomolgus CD127 / IL-7RA Protein (His Tag)Human IL5 / Interleukin 5 ProteinHuman IL13 / ALRH ProteinHuman IL3 / IL-3 ProteinCynomolgus IL13 / ALRH ProteinHuman CD122 / IL-2RB ProteinMouse IL-4R / CD124 Protein (ECD, His Tag)Mouse CD122 / IL2RB / IL2 Receptor beta Protein (His Tag)Human Interleukin-32 / IL-32 Protein (isoform alpha, His Tag)Human IL13RA1 Protein (His Tag)Human CD122 / IL-2RB Protein (Fc Tag)Cynomolgus IL-21R / Interleukin-21 Receptor Protein (His Tag)Cynomolgus / Rhesus IL21R / IL-21R Protein (Fc Tag)Human IL2 / Interleukin-2 Protein (L35M, L36S, C142A)Cynomolgus IL2RA Protein (Fc Tag)Cynomolgus IL2RA Protein (His Tag)Cynomolgus IL-8 / CXCL8 ProteinMouse IL2RA / CD25 Protein (His Tag)Human IL13RA2 / IL13R Protein (His & Fc Tag)Human Interleukin-2 / IL-2 ProteinHuman IL-15 / IL15 / Interleukin 15 Protein (His Tag)Mouse Interleukin-2 / IL-2 ProteinMouse IL4 / Interleukin-4 Protein (Q136D, Y139D, His Tag)Human IL13 / ALRH Protein (Fc Tag)Mouse IL5Ra / CD125 Protein (His Tag)Human IL5Ra / CD125 Protein (His Tag)Human IL-21R / Interleukin-21 Receptor Protein (His Tag)Human IL4R / CD124 Protein (His Tag)Canine IL-8 / CXCL8 ProteinCanine Interleukin-2 / IL-2 Protein (147 Cys/Ser)Human IL-8 / CXCL8 Protein (aa 1-77, Fc Tag)Human IL-8 / CXCL8 Protein (aa 6-77, Fc Tag)Human IL-8 / CXCL8 Protein (aa 1-77)Human IL-8 / CXCL8 Protein (aa 6-77)Human IL16 / Interleukin-16 Protein (His Tag)Human IL13RA1 Protein (His & Fc Tag)
Background

The common gamma chain (γc) (or CD132), also known as interleukin-2 receptor subunit gamma or IL2RG, is a member of the type I cytokine receptor family expressed on most lymphocyte (white blood cell) populations, and its gene is found on the X-chromosome of mammals. The common gamma chain (γc) (or IL2RG), is a cytokine receptor sub-unit that is common to the receptor complexes for at least six different interleukin receptors: IL-2, IL-4, IL-7, IL-9, IL-15 and interleukin-21 receptor. It is a component of multiple cytokine receptors that are essential for lymphocyte development and function. X-linked severe combined immunodeficiency (XSCID) is a rare and potentially fatal disease caused by mutations of IL2RG, the gene encoding IL2RG. IL2RG was demonstrated to be a component of the IL-4 receptor on the basis of chemical cross-linking data, the ability of IL2RG to augment IL-4 binding affinity, and the requirement for IL-2R gamma in IL-4-mediated phosphorylation of insulin receptor substrate-1. The observation that IL-2R gamma is a functional component of the IL-4 receptor, together with the finding that IL-2R gamma associates with the IL-7 receptor, begins to elucidate why deficiency of this common gamma chain (gamma c) has a profound effect on lymphoid function and development, as seen in X-linked severe combined immunodeficiency.

References
  • Russell SM, et al. (1993) Interleukin-2 receptor gamma chain: a functional component of the interleukin-4 receptor. Science. 262 (5141): 1880-3.
  • Miyazaki T, et al. (1994) Functional activation of Jak1 and Jak3 by selective association with IL-2 receptor subunits. Science. 266 (5187): 1045-7.
  • Takeshita T, et al. (1992) Cloning of the gamma chain of the human IL-2 receptor. Science. 257 (5068): 379-82.
  • Catalog:HG10555-M-F
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Human IL2RG Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"