After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Human IL23R / IL23 Receptor Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human IL23R cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human IL23R Gene Plasmid Map
Human IL23R Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

IL23R, also known as IL23 receptor, belongs to the type I cytokine receptor family, Type 2 subfamily. It contains 2 fibronectin type-III domains and is expressed by monocytes, Th1, Th0, NK and dendritic cells. Isoform 1 is specifically expressed in NK cells. IL23R associates with IL12RB1 to form the interleukin-23 receptor. It binds IL23 and mediates T-cells, NK cells and possibly certain macrophage/myeloid cells stimulation probably through activation of the Jak-Stat signaling cascade. IL23 functions in innate and adaptive immunity and may participate in acute response to infection in peripheral tissues. IL23 may be responsible for autoimmune inflammatory diseases and be important for tumorigenesis. Genetic variations in IL23R are associated with inflammatory bowel disease type 17 (IBD17). IBD17 is a chronic, relapsing inflammation of the gastrointestinal tract with a complex etiology. Genetic variations in IL23R also can cause susceptibility to psoriasis type 7.

  • Duerr RH, et al. (2006) A genome-wide association study identifies IL23R as an inflammatory bowel disease gene. Science. 314(5804):1461-3.
  • Cargill M, et al. (2007) A large-scale genetic association study confirms IL12B and leads to the identification of IL23R as psoriasis-risk genes. Am J Hum Genet. 80(2):273-90.
  • Dubinsky MC, et al. (2007) IL-23 receptor (IL-23R) gene protects against pediatric Crohn's disease. Inflamm Bowel Dis. 13(5):511-5.
  • Tremelling M, et al. (2007) IL23R variation determines susceptibility but not disease phenotype in inflammatory bowel disease. Gastroenterology. 132(5):1657-64.
  • Contact Us
    • Human IL23R Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.