IL20RA cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10397-M-F

NOT AVAILABLE

Contact us:
215-583-7898
order@sinobiological.com
Distributors
All IL20RA Reagents
CRO Services

All IL20RA Reagents
IL20RA cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1662 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 20 receptor, alpha (IL20RA) with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV2-FLAG
Restriction Sites
KpnI + XhoI (5.4kb + 1.71kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
IL20RA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL20RA cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CRF2-8 cDNA ORF Clone, Human;IL-20R-alpha cDNA ORF Clone, Human;IL-20R1 cDNA ORF Clone, Human;IL-20RA cDNA ORF Clone, Human
IL20RA Background Information

Interleukin 20 receptor, alpha subunit (IL20RA/IL-20RA) also known as IL-20 receptor subunit alpha, Cytokine receptor class-II member 8, interleukin-20 receptor I, and interleukin-20 receptor subunit alpha, is a subunit for the interleukin-20 receptor. IL20RA/IL-20RA belongs to the type II cytokine receptor family. This cytokine is a receptor for interleukin 20 (IL20), a cytokine that may be involved in epidermal function. The receptor of IL20 is a heterodimeric receptor complex consisting of this protein and interleukin 20 receptor beta (IL20B). IL20RA forms heterodimer with IL20RB, and the complex serves as a receptor for IL19, IL20 and IL24. All three are capable of signaling through IL-20RA/IL-20RB complex. The ligand binding to receptor B creating a high-affinity binding site for the receptor A which is recruited to complete the complex. In addition, IL20RA also forms a heterodimer with the unique and specific receptor IL10RB and functions as the receptor for IL26. IL20RA is widely expressed with highest levels in skin, testis and brain. The expression of both IL20RA and IL20RB is found to be upregulated in psoriatic skin lesions on keratinocytes.

Full Name
interleukin 20 receptor, alpha
References
  • Parrish-Novak J, et al. (2002) Interleukins 19, 20, and 24 signal through two distinct receptor complexes. Differences in receptor-ligand interactions mediate unique biological functions. J Biol Chem. 277(49): 47517-23.
  • Kingo K, et al. (2008) Association analysis of IL20RA and IL20RB genes in psoriasis. Genes Immun. 9(5): 445-51.
  • Blumberg H, et al. (2001) Interleukin 20: discovery, receptor identification, and role in epidermal function. Cell. 104(1): 9-19.
  • IL20RA cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IL20RA cDNA ORF Clone, Canine, C-GFPSpark® tag DG70080-ACG

    IL20RA cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL20RA cDNA ORF Clone in Cloning Vector, Rat RG80227-G
    IL20RA cDNA ORF Clone, Rat, untagged RG80227-UT
    IL20RA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80227-ACGLN
    IL20RA cDNA ORF Clone, Rat, C-GFPSpark® tag RG80227-ACG
    IL20RA cDNA ORF Clone, Rat, C-OFPSpark® tag RG80227-ACR
    IL20RA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80227-CF
    IL20RA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80227-NF
    IL20RA cDNA ORF Clone, Rat, C-His tag RG80227-CH
    IL20RA cDNA ORF Clone, Rat, N-His tag RG80227-NH
    IL20RA cDNA ORF Clone, Rat, C-HA tag RG80227-CY
    IL20RA cDNA ORF Clone, Rat, N-HA tag RG80227-NY
    IL20RA cDNA ORF Clone, Rat, C-Myc tag RG80227-CM
    IL20RA cDNA ORF Clone, Rat, N-Myc tag RG80227-NM
    IL20RA qPCR Primer Pairs, Rat RP300217

    IL20RA cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL20RA cDNA ORF Clone in Cloning Vector, Human HG10397-M
    IL20RA cDNA ORF Clone, Human, untagged HG10397-UT
    IL20RA cDNA ORF Clone, Human, C-GFPSpark® tag HG10397-ACG
    IL20RA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10397-ACGLN
    IL20RA cDNA ORF Clone, Human, C-OFPSpark® tag HG10397-ACR
    IL20RA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10397-CF
    IL20RA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10397-NF
    IL20RA cDNA ORF Clone, Human, C-His tag HG10397-CH
    IL20RA cDNA ORF Clone, Human, N-His tag HG10397-NH
    IL20RA cDNA ORF Clone, Human, C-HA tag HG10397-CY
    IL20RA cDNA ORF Clone, Human, N-HA tag HG10397-NY
    IL20RA cDNA ORF Clone, Human, C-Myc tag HG10397-CM
    IL20RA cDNA ORF Clone, Human, N-Myc tag HG10397-NM
    IL20RA qPCR Primer Pairs, Human HP100429
    info info
    添加购物车成功! 添加购物车失败!