Quick Order

Human IL-1RA/IL1RN transcript variant 1 Gene ORF cDNA clone expression plasmid

  • Human IL1RN / IL1F3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human IL1F3/IL1RA cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Species:Human
Vector:
Plasmid:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
( We provide with IL1RN qPCR primers for gene expression analysis, HP100096 )
Promoter:
Application:
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:
Shipping_carrier:
Storage:
Human IL1F3/IL1RA Gene Plasmid Map
Human IL1RN / IL1F3 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Background

Interleukin-1 receptor antagonist (IL-1RA) also known as IL1RN is a member of the interleukin 1 cytokine family. This protein inhibits the activities of interleukin 1, alpha (IL1A) and interleukin 1, beta (IL1B), and modulates a variety of interleukin 1 related immune and inflammatory responses. A polymorphism of this protein encoding gene is reported to be associated with increased risk of osteoporotic fractures and gastric cancer. IL-1RA/IL1RN may inhibit the activity of IL-1 by binding to its receptor and it has no IL-1 like activity. Genetic variation in IL-1RA/IL1RN is associated with susceptibility to microvascular complications of diabetes type 4 (MVCD4). These are pathological conditions that develop in numerous tissues and organs as a consequence of diabetes mellitus. They include diabetic retinopathy, diabetic nephropathy leading to end-stage renal disease, and diabetic neuropathy. Diabetic retinopathy remains the major cause of new-onset blindness among diabetic adults. It is characterized by vascular permeability and increased tissue ischemia and angiogenesis. Defects in IL-1RA/IL1RN are the cause of interleukin 1 receptor antagonist deficiency (DIRA) which is also known as deficiency of interleukin 1 receptor antagonist. Autoinflammatory diseases manifest inflammation without evidence of infection, high-titer autoantibodies, or autoreactive T-cells. DIRA is a rare, autosomal recessive, genetic autoinflammatory disease that results in sterile multifocal osteomyelitis, and pustulosis from birth.

References
  • Langdahl BL, et al. (2000) Osteoporotic fractures are associated with an 86-base pair repeat polymorphism in the interleukin-1--receptor antagonist gene but not with polymorphisms in the interleukin-1beta gene. J Bone Miner. 15 (3): 402-14.
  • El-Omar EM, et al. (2000) Interleukin-1 polymorphisms associated with increased risk of gastric cancer. Nature. 404 (6776): 398-402.
  • Steinkasserer A, et al. (1992) The human IL-1 receptor antagonist gene (IL1RN) maps to chromosome 2q14-q21, in the region of the IL-1 alpha and IL-1 beta loci. Genomics. 13 (3): 654-7.
  • Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"