ST2 cDNA ORF Clone, Human, untagged

Cat: HG10105-M-N
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All ST2 Reagents
CRO Services

All ST2 Reagents
ST2 cDNA ORF Clone, Human, untagged General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
987 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 1 receptor-like 1, transcript variant 2 DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
KpnI + XhoI
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
ST2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

ST2 cDNA ORF Clone, Human, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 7139
ST2 cDNA ORF Clone, Human, untagged Alternative Names
DER4 cDNA ORF Clone, Human;FIT-1 cDNA ORF Clone, Human;IL1RL1 cDNA ORF Clone, Human;IL33R cDNA ORF Clone, Human;IL‑1 R4 cDNA ORF Clone, Human;ST2 cDNA ORF Clone, Human;ST2L cDNA ORF Clone, Human;ST2V cDNA ORF Clone, Human;T1 cDNA ORF Clone, Human
ST2 Background Information

IL-1 receptor–like 1 (IL1RL1) is a membrane receptor involved in TH2 inflammatory responses and eosinophilia. It has previously been described that levels of the interlukin-1 like 1 (IL1RL1) protein can be used to diagnose cardiovascular disease and determine the prognosis for a patient with cardiovascular disease. The ligand for IL1RL1 has been described, and named IL-33. Mutants in IL1RL1 have been associated with blood eosinophil counts in a genome-wide association study and with asthma in family-based and case-control studies. As an important mediator involved in many immune and inflammatory responses, this cytokine has been implicated as a regulator of both the development and effector phases of type 2 helper T cell responses, and as a negative feedback modulator of macrophage pro-inflammatory function. IL33 is a specific ligand of ST2L and induces production of Th2 cytokines.

Full Name
interleukin 1 receptor-like 1
References
  • Savenije OE, et al. (2011) Interleukin-1 receptor-like 1 polymorphisms are associated with serum IL1RL1-a, eosinophils, and asthma in childhood. J Allergy Clin Immunol. 127(3): 750-6.
  • Li H, et al. (2000) The cloning and nucleotide sequence of human ST2L cDNA. Genomics. 67(3): 284-90.
  • ST2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    ST2 cDNA ORF Clone in Cloning Vector, Mouse MG51143-G
    ST2 cDNA ORF Clone, Mouse, untagged MG51143-UT
    ST2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51143-ACGLN
    ST2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51143-ACG
    ST2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51143-ACR
    ST2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51143-CF
    ST2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51143-NF
    ST2 cDNA ORF Clone, Mouse, C-His tag MG51143-CH
    ST2 cDNA ORF Clone, Mouse, N-His tag MG51143-NH
    ST2 cDNA ORF Clone, Mouse, C-HA tag MG51143-CY
    ST2 cDNA ORF Clone, Mouse, N-HA tag MG51143-NY
    ST2 cDNA ORF Clone, Mouse, C-Myc tag MG51143-CM
    ST2 cDNA ORF Clone, Mouse, N-Myc tag MG51143-NM

    ST2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    ST2 cDNA ORF Clone in Cloning Vector, Human HG10105-M
    ST2 cDNA ORF Clone, Human, untagged HG10105-UT
    ST2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10105-ACGLN
    ST2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10105-ACG
    ST2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10105-ACR
    ST2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10105-CF
    ST2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10105-NF
    ST2 cDNA ORF Clone, Human, C-His tag HG10105-CH
    ST2 cDNA ORF Clone, Human, N-His tag HG10105-NH
    ST2 cDNA ORF Clone, Human, C-HA tag HG10105-CY
    ST2 cDNA ORF Clone, Human, N-HA tag HG10105-NY
    ST2 cDNA ORF Clone, Human, C-Myc tag HG10105-CM
    ST2 cDNA ORF Clone, Human, N-Myc tag HG10105-NM
    ST2 qPCR Primer Pairs, Human HP100184
    info info
    添加购物车成功! 添加购物车失败!