Quick Order

Human IL-1RAcP/IL-1R3 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human IL1R3 cDNA Clone Product Information
NCBI RefSeq:NM_002182.2
RefSeq ORF Size:1713bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 1 receptor accessory protein with Flag tag.
Gene Synonym:IL1RAP, IL1R3, C3orf13, FLJ37788, IL-1RAcP
Restriction Site:KpnI + XhoI (5.5kb + 1.74kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human IL1R3 Gene Plasmid Map
Human IL1RAP / IL1R3 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Interleukin-1 receptor accessory protein (IL-1RAcP) also known as Interleukin-1 receptor member 3 (IL-1R3) is a a cytokine receptor which binds interleukin 1. The IL-1 receptor accessory protein (IL1RAP) is a transmembrane protein that interacts with IL-1R and is required for IL-1 signal transduction. Interleukin 1 induces synthesis of acute phase and proinflammatory proteins during infection, tissue damage, or stress, by forming a complex at the cell membrane with an interleukin 1 receptor and an accessory protein. IL-1RAcP/IL-1R3 is a necessary part of the interleukin 1 receptor complex which initiates signalling events that result in the activation of interleukin 1-responsive genes. Alternative splicing of this gene results in two transcript variants encoding two different isoforms, one membrane-bound and one soluble. The ratio of soluble to membrane-bound forms increases during acute-phase induction or stress. IL-1RAcP/IL-1R3 mediates interleukin-1-dependent activation of NF-kappa-B. Isoform 1 is part of the membrane-bound form of the IL-1 receptor. Signaling involves formation of a ternary complex containing IL1R1, TOLLIP, MYD88, and IRAK1 or IRAK2. Isoform 2 modulates the response to interleukins by associating with soluble IL1R1 and enhancing interleukin-binding to the decoy receptor.

  • Goldbach-Mansky R, et al. (2009) Autoinflammation: the prominent role of IL-1 in monogenic autoinflammatory diseases and implications for common illnesses. J Allergy Clin Immunol. 124(6): 1141-9.
  • Johnston A, et al. (2011) IL-1F5, -F6, -F8, and -F9: a novel IL-1 family signaling system that is active in psoriasis and promotes keratinocyte antimicrobial peptide expression. J Immunol. 186(4): 2613-22.
  • Ozaki K, et al. (2001) Effect of tumor weight and tube feeding on TNF-alpha and IL-1beta mRNA expression in the brain of mice. JPEN J Parenter Enteral Nutr. 25(6): 317-22.
  • Contact Us
    • Human IL1RAP / IL1R3 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.