IL1R2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10111-M-F
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL1R2 Reagents
CRO Services

All IL1R2 Reagents
IL1R2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
1197 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 1 receptor, type I I, transcript variant 1 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI (5.5kb + 1.23kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
IL1R2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL1R2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human G-CSF/CSF3 Gene Plasmid Map 7153
IL1R2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
CD121b cDNA ORF Clone, Human;CDw121b cDNA ORF Clone, Human;IL-1R-2 cDNA ORF Clone, Human;IL-1RT-2 cDNA ORF Clone, Human;IL-1RT2 cDNA ORF Clone, Human;IL1R2c cDNA ORF Clone, Human;IL1RB cDNA ORF Clone, Human
IL1R2 Background Information

Interleukin 1 receptor, type II (IL1R2) also known as CD121b (Cluster of Differentiation 121b) is a cytokine receptor that belongs to the interleukin-1 receptor family. This protein binds interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I (IL1R1/IL1RA), and acts as a decoy receptor that inhibits the activity of its ligands. The pleiotropic cytokine IL1 is produced to regulate development and maintenance of the inflammatory responses, and binds to specific plasma membrane receptors on cells. Two distinct types of IL1 receptors which are able to bind IL1 specifically have been identified, designated as IL1RI (IL1RA) and IL1RII (IL1RB). IL1R1 contributes to IL-1 signaling, whereas the IL-1R2/CD121b has no signaling property and acts as a decoy for IL-1. IL-1R2/CD121b structurally consisting of a ligand binding portion comprised of three Ig-like domains, a single transmembrane region, and a short cytoplasmic domain, is expressed in a variety of cell types including B lymphocytes, neutrophils, monocytes, large granular leukocytes and endothelial cells. Interleukin 4 (IL4) is reported to antagonize the activity of interleukin 1 by inducing the expression and release of this cytokine.

Full Name
interleukin 1 receptor, type II
References
  • Cannon JG, et al. (1997) Interleukin-1 beta, interleukin-1 receptor antagonist, and soluble interleukin-1 receptor type II secretion in chronic fatigue syndrome. J Clin Immunol. 17 (3): 253-61.
  • Liu C, et al. (1996) Cloning and characterization of an alternatively processed human type II interleukin-1 receptor mRNA. J Biol Chem. 271 (34): 20965-72.
  • Van der Poll T, et al. (1997) Antiinflammatory cytokine responses during clinical sepsis and experimental endotoxemia: sequential measurements of plasma soluble interleukin (IL)-1 receptor type II, IL-10, and IL-13. J Infect Dis. 175 (1): 118-22.
  • IL1R2 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    IL1R2 cDNA ORF Clone in Cloning Vector, Rhesus CG90120-G
    IL1R2 cDNA ORF Clone, Rhesus, untagged CG90120-UT
    IL1R2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90120-ACG
    IL1R2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90120-ACGLN
    IL1R2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90120-ACR
    IL1R2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90120-CF
    IL1R2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90120-NF
    IL1R2 cDNA ORF Clone, Rhesus, C-His tag CG90120-CH
    IL1R2 cDNA ORF Clone, Rhesus, N-His tag CG90120-NH
    IL1R2 cDNA ORF Clone, Rhesus, C-HA tag CG90120-CY
    IL1R2 cDNA ORF Clone, Rhesus, N-HA tag CG90120-NY
    IL1R2 cDNA ORF Clone, Rhesus, C-Myc tag CG90120-CM
    IL1R2 cDNA ORF Clone, Rhesus, N-Myc tag CG90120-NM

    IL1R2 cDNA ORF Clone, Canine, Related Products

    Product Name Catalog#(PDF)
    IL1R2 cDNA ORF Clone in Cloning Vector, Canine DG70093-G
    IL1R2 cDNA ORF Clone, Canine, untagged DG70093-UT
    IL1R2 cDNA ORF Clone, Canine, C-GFPSpark® tag DG70093-ACG
    IL1R2 Lentiviral cDNA ORF Clone, Canine, C-GFPSpark® tag DG70093-ACGLN
    IL1R2 cDNA ORF Clone, Canine, C-OFPSpark® tag DG70093-ACR
    IL1R2 cDNA ORF Clone, Canine, C-DDK (Flag®) tag DG70093-CF
    IL1R2 cDNA ORF Clone, Canine, N-DDK (Flag®) tag DG70093-NF
    IL1R2 cDNA ORF Clone, Canine, C-His tag DG70093-CH
    IL1R2 cDNA ORF Clone, Canine, N-His tag DG70093-NH
    IL1R2 cDNA ORF Clone, Canine, C-HA tag DG70093-CY
    IL1R2 cDNA ORF Clone, Canine, N-HA tag DG70093-NY
    IL1R2 cDNA ORF Clone, Canine, C-Myc tag DG70093-CM
    IL1R2 cDNA ORF Clone, Canine, N-Myc tag DG70093-NM

    IL1R2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    IL1R2 cDNA ORF Clone in Cloning Vector, Rat RG80196-G
    IL1R2 cDNA ORF Clone, Rat, untagged RG80196-UT
    IL1R2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80196-ACGLN
    IL1R2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80196-ACG
    IL1R2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80196-ACR
    IL1R2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80196-CF
    IL1R2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80196-NF
    IL1R2 cDNA ORF Clone, Rat, C-His tag RG80196-CH
    IL1R2 cDNA ORF Clone, Rat, N-His tag RG80196-NH
    IL1R2 cDNA ORF Clone, Rat, C-HA tag RG80196-CY
    IL1R2 cDNA ORF Clone, Rat, N-HA tag RG80196-NY
    IL1R2 cDNA ORF Clone, Rat, C-Myc tag RG80196-CM
    IL1R2 cDNA ORF Clone, Rat, N-Myc tag RG80196-NM
    IL1R2 qPCR Primer Pairs, Rat RP300188

    IL1R2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    IL1R2 cDNA ORF Clone in Cloning Vector, Mouse MG51090-G
    IL1R2 cDNA ORF Clone, Mouse, untagged MG51090-UT
    IL1R2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51090-ACGLN
    IL1R2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51090-ACG
    IL1R2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51090-ACR
    IL1R2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51090-CF
    IL1R2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51090-NF
    IL1R2 cDNA ORF Clone, Mouse, C-His tag MG51090-CH
    IL1R2 cDNA ORF Clone, Mouse, N-His tag MG51090-NH
    IL1R2 cDNA ORF Clone, Mouse, C-HA tag MG51090-CY
    IL1R2 cDNA ORF Clone, Mouse, N-HA tag MG51090-NY
    IL1R2 cDNA ORF Clone, Mouse, C-Myc tag MG51090-CM
    IL1R2 cDNA ORF Clone, Mouse, N-Myc tag MG51090-NM
    IL1R2 qPCR Primer Pairs, Mouse MP201048

    IL1R2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    IL1R2 cDNA ORF Clone in Cloning Vector, Human HG10111-M
    IL1R2 cDNA ORF Clone, Human, untagged HG10111-UT
    IL1R2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10111-ACG
    IL1R2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10111-ACGLN
    IL1R2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10111-ACR
    IL1R2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10111-CF
    IL1R2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10111-NF
    IL1R2 cDNA ORF Clone, Human, C-His tag HG10111-CH
    IL1R2 cDNA ORF Clone, Human, N-His tag HG10111-NH
    IL1R2 cDNA ORF Clone, Human, C-HA tag HG10111-CY
    IL1R2 cDNA ORF Clone, Human, N-HA tag HG10111-NY
    IL1R2 cDNA ORF Clone, Human, C-Myc tag HG10111-CM
    IL1R2 cDNA ORF Clone, Human, N-Myc tag HG10111-NM
    IL1R2 qPCR Primer Pairs, Human HP100186
    info info
    添加购物车成功! 添加购物车失败!