Quick Order

Human IL-1R2/CD121b transcript variant 1 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human IL1R2 cDNA Clone Product Information
NCBI RefSeq:NM_004633.3
RefSeq ORF Size:1197bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 1 receptor, type I I, transcript variant 1 with Flag tag.
Gene Synonym:IL1R2, IL1RB, CD121b, MGC47725
Restriction Site:KpnI + XhoI (5.5kb + 1.23kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human IL1R2 Gene Plasmid Map
Human IL1R2 / CD121b transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Interleukin 1 receptor, type II (IL1R2) also known as CD121b (Cluster of Differentiation 121b) is a cytokine receptor that belongs to the interleukin-1 receptor family. This protein binds interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I (IL1R1/IL1RA), and acts as a decoy receptor that inhibits the activity of its ligands. The pleiotropic cytokine IL1 is produced to regulate development and maintenance of the inflammatory responses, and binds to specific plasma membrane receptors on cells. Two distinct types of IL1 receptors which are able to bind IL1 specifically have been identified, designated as IL1RI (IL1RA) and IL1RII (IL1RB). IL1R1 contributes to IL-1 signaling, whereas the IL-1R2/CD121b has no signaling property and acts as a decoy for IL-1. IL-1R2/CD121b structurally consisting of a ligand binding portion comprised of three Ig-like domains, a single transmembrane region, and a short cytoplasmic domain, is expressed in a variety of cell types including B lymphocytes, neutrophils, monocytes, large granular leukocytes and endothelial cells. Interleukin 4 (IL4) is reported to antagonize the activity of interleukin 1 by inducing the expression and release of this cytokine.

  • Cannon JG, et al. (1997) Interleukin-1 beta, interleukin-1 receptor antagonist, and soluble interleukin-1 receptor type II secretion in chronic fatigue syndrome. J Clin Immunol. 17 (3): 253-61.
  • Liu C, et al. (1996) Cloning and characterization of an alternatively processed human type II interleukin-1 receptor mRNA. J Biol Chem. 271 (34): 20965-72.
  • Van der Poll T, et al. (1997) Antiinflammatory cytokine responses during clinical sepsis and experimental endotoxemia: sequential measurements of plasma soluble interleukin (IL)-1 receptor type II, IL-10, and IL-13. J Infect Dis. 175 (1): 118-22.
  • Size / Price
    Catalog: HG10111-M-F
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    • Human IL1R2 / CD121b transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.