Quick Order

Human IL36G Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Human IL1F9 cDNA Clone Product Information
NCBI RefSeq:NM_019618.2
RefSeq ORF Size:510bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 1 family, member 9 (IL1F9) with His tag.
Gene Synonym:IL1E, IL1H1, IL-1F9, IL-1H1, IL1RP2, IL-1RP2
Species:Human
Vector:pCMV/hygro-His
Plasmid:pCMV-IL1F9-10his
Restriction Site:KpnI + XhoI (5.5kb + 0.54kb)
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human IL1F9 Gene Plasmid Map
Human IL36G / IL1F9 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
pCMV/hygro-HIs Vector Information
 
Vector Name pCMV/hygro-His
Vector Size 5687bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

Schematic of pCMV/hygro-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
  • Dinarello CA. (2002) The IL-1 family and inflammatory diseases. Clin Exp Rheumatol. 20(5): 1-13.
  • Berglof E, et al. (2003) IL-1Rrp2 expression and IL-1F9 (IL-1H1) actions in brain cells. J Neuroimmunol. 139(1-2): 36-43.
  • Dunn E, et al. (2001) Annotating genes with potential roles in the immune system: six new members of the IL-1 family. Trends Immunol.22(10): 533-6.
  • Towne JE, et al. (2004) Interleukin (IL)-1F6, IL-1F8, and IL-1F9 signal through IL-1Rrp2 and IL-1RAcP to activate the pathway leading to NF-kappaB and MAPKs. J Biol Chem. 279(14): 13677-88.
  • Size / Price
    Catalog: HG10124-M-H
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Human IL36G / IL1F9 Gene cDNA Clone (full-length ORF Clone), expression ready, His-tagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"