Quick Order

Text Size:AAA

Human IL1F10 / IL-38 transcript variant 1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human IL1F10 cDNA Clone Product Information
NCBI RefSeq:NM_032556.4
RefSeq ORF Size:459bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 1 family, member 10 (theta), transcript variant 1.
Gene Synonym:IL1F10, FKSG75, IL-1HY2, IL1-theta, MGC119831, MGC119832, MGC119833, FIL1-theta
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-IL1F10
Restriction Site:KpnI + XhoI (5.5kb + 0.46kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the 72T/C,152C/A , neither of which results in the variation of encoded amino acids.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human IL1F10 Gene Plasmid Map
Human IL1F10 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Size / Price
Catalog: HG10122-M-N
List Price: 
Price:      (You Save: )
Size:
Quantity:+-
AvailabilityIn Stock
Bulk Discount InquiryAdd to Cart
Contact Us
Images
  • Human IL1F10 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Recently Viewed Items
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
      Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"