Quick Order

Human IL1F10 / IL-38 transcript variant 1 Gene ORF cDNA clone expression plasmid

  • Human IL1F10 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
DatasheetReviewsRelated ProductsProtocols
Human IL1F10 cDNA Clone Product Information
NCBI RefSeq:NM_032556.4
RefSeq ORF Size:459bp
cDNA Description:Full length Clone DNA of Homo sapiens interleukin 1 family, member 10 (theta), transcript variant 1.
Gene Synonym:IL1F10, FKSG75, IL-1HY2, IL1-theta, MGC119831, MGC119832, MGC119833, FIL1-theta
Restriction Site:KpnI + XhoI (5.5kb + 0.46kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the 72T/C,152C/A , neither of which results in the variation of encoded amino acids.
( We provide with IL1F10 qPCR primers for gene expression analysis, HP100196 )
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicillin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human IL1F10 Gene Plasmid Map
Human IL1F10 transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Size / Price
Catalog: HG10122-M-N
List Price: 
Price:      (You Save: )
AvailabilityIn Stock
Add to CartBulk Discount Inquiry

Datasheet & Documentation

Contact Us
All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.