IL1F10 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG10122-M-F
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All IL1F10 Reagents
CRO Services

All IL1F10 Reagents
IL1F10 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
459 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the 72T/C,152C/A , neither of which results in the variation of encoded amino acids.
Description
Full length Clone DNA of Human interleukin 1 family, member 10 (theta), transcript variant 1 with Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI (5.5kb + 0.49kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
IL1F10 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL1F10 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human G-CSF/CSF3 Gene Plasmid Map 7153
IL1F10 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
FIL1-theta cDNA ORF Clone, Human;FKSG75 cDNA ORF Clone, Human;IL-1HY2 cDNA ORF Clone, Human;IL-38 cDNA ORF Clone, Human;IL1-theta cDNA ORF Clone, Human;IL1HY2 cDNA ORF Clone, Human
IL1F10 Background Information
Full Name
interleukin 1 family, member 10 (theta)

IL1F10 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
IL1F10 cDNA ORF Clone in Cloning Vector, Mouse MG51301-G
IL1F10 cDNA ORF Clone, Mouse, untagged MG51301-UT
IL1F10 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51301-ACGLN
IL1F10 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51301-ACG
IL1F10 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51301-ACR
IL1F10 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51301-CF
IL1F10 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51301-NF
IL1F10 cDNA ORF Clone, Mouse, C-His tag MG51301-CH
IL1F10 cDNA ORF Clone, Mouse, N-His tag MG51301-NH
IL1F10 cDNA ORF Clone, Mouse, C-HA tag MG51301-CY
IL1F10 cDNA ORF Clone, Mouse, N-HA tag MG51301-NY
IL1F10 cDNA ORF Clone, Mouse, C-Myc tag MG51301-CM
IL1F10 cDNA ORF Clone, Mouse, N-Myc tag MG51301-NM
IL1F10 qPCR Primer Pairs, Mouse MP201179

IL1F10 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
IL1F10 cDNA ORF Clone in Cloning Vector, Human HG10122-M
IL1F10 cDNA ORF Clone, Human, untagged HG10122-UT
IL1F10 cDNA ORF Clone, Human, C-GFPSpark® tag HG10122-ACG
IL1F10 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10122-ACGLN
IL1F10 cDNA ORF Clone, Human, C-OFPSpark® tag HG10122-ACR
IL1F10 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10122-CF
IL1F10 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10122-NF
IL1F10 cDNA ORF Clone, Human, C-His tag HG10122-CH
IL1F10 cDNA ORF Clone, Human, N-His tag HG10122-NH
IL1F10 cDNA ORF Clone, Human, C-HA tag HG10122-CY
IL1F10 cDNA ORF Clone, Human, N-HA tag HG10122-NY
IL1F10 cDNA ORF Clone, Human, C-Myc tag HG10122-CM
IL1F10 cDNA ORF Clone, Human, N-Myc tag HG10122-NM
IL1F10 qPCR Primer Pairs, Human HP100196
info info
添加购物车成功! 添加购物车失败!