Quick Order

DatasheetReviewsRelated ProductsProtocols
Human IL1A cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:
Human IL1A Gene Plasmid Map
Human IL1F1 / IL1α Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

IL-1 alpha is a member of the interleukin 1 cytokine family. Cytokines are proteinaceous signaling compounds that are major mediators of the immune response. They control many different cellular functions including proliferation, differentiation and cell survival/apoptosis but are also involved in several pathophysiological processes including viral infections and autoimmune diseases. Cytokines are synthesized under various stimuli by a variety of cells of both the innate (monocytes, macrophages, dendritic cells) and adaptive (T- and B-cells) immune systems. Cytokines can be classified into two groups: pro- and anti-inflammatory. Pro-inflammatory cytokines, including IFNgamma, IL-1, IL-6 and TNF-alpha, are predominantly derived from the innate immune cells and Th1 cells. Anti-inflammatory cytokines, including IL-10, IL-4, IL-13 and IL-5, are synthesized from Th2 immune cells. IL-1 alpha is a pleiotropic cytokine involved in various immune responses, inflammatory processes, and hematopoiesis. It is produced by monocytes and macrophages as a proprotein, which is proteolytically processed and released in response to cell injury, and thus induces apoptosis. IL-1 alpha stimulates thymocyte proliferation by inducing IL-2 release, B-cell maturation and proliferation, and fibroblast growth factor activity.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

  • Nicklin MJ,et al. (1994) A physical map of the region encompassing the human interleukin-1 alpha, interleukin-1 beta, and interleukin-1 receptor antagonist genes. Genomics. 19(2):382-4.
  • March CJ, et al. (1985) Cloning, sequence and expression of two distinct human interleukin-1 complementary DNAs. Nature. 315(6021):641-7.
  • Bankers-Fulbright JL, et al. (1996) Interleukin-1 signal transduction. Life Sci. 59(2):61-83.
  • Dinarello CA, et al. (1997) Induction of interleukin-1 and interleukin-1 receptor antagonist. Semin Oncol. 24 (3 Suppl 9):S9-81-S9-93.
  • Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.