Quick Order

Text Size:AAA

Human IL18/IL-18/Interleukin 18 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human IL18 cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human IL18 Gene Plasmid Map
Human IL18 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
pCMV/hygro-FLAG Vector Information
Vector Name pCMV/hygro-FLAG
Vector Size 5681bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Interleukin-18 (IL-18, also known as interferon-gamma inducing factor) is a proinflammatory cytokine that belongs to the IL-1 superfamily and is produced by macrophages and other cells. This cytokine can induce the IFN-gamma production of T cells. The combination of IL-18 and IL12 has been shown to inhibit IL4 dependent IgE and IgG1 production, and enhance IgG2a production of B cells. IL-18 binding protein (IL18BP) can specifically interact with this cytokine, and thus negatively regulate its biological activity. IL-18 is an IL-1−like cytokine that requires cleavage with caspase-1 to become active, was found to increase IgE production in a CD4+ T cells-, IL-4− and STAT6−dependent fashion. IL-18 and T cell receptor−mediated stimulation could induce naïve CD4+ T cells to develop into IL-4−producing cells in vitro. Thus, caspase-1 and IL-18 may be critical in regulation of IgE production in vivo, providing a potential therapeutic target for allergic disorders. IL-18 production in primary synovial cultures and purified synovial fibroblasts was, in turn, upregulated by TNF-α and IL-1β, suggesting that monokine expression can feed back to promote Th1 cell development in synovial membrane. Besides, synergistic combinations of IL-18, IL-12, and IL-15 may be of importance in sustaining both Th1 responses and monokine production in RA.

  • Dinarello CA. (1999) IL-18: A TH1-inducing, proinflammatory cytokine and new member of the IL-1 family. J Allergy Clin Immunol. 103: 11-24.
  • Takeda K, et al.. (1998) Defective NK cell activity and Th1 response in IL-18-deficient mice. Immunity. 8(3): 383-90.
  • Gracie JA, et al.. (1999) A proinflammatory role for IL-18 in rheumatoid arthritis. J Clin Invest. 104(10): 1393-401.
  • Contact Us
    • Human IL18 Gene cDNA Clone (full-length ORF Clone), expression ready, FLAG-tagged
      All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.