Text Size:AAA

Mouse IL13 / ALRH Gene cDNA Clone (full-length ORF Clone), expression ready, untagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
IL13/ALRHcDNA Clone Product Information
Gene Bank Ref.ID:NM_008355.2
cDNA Size:396
cDNA Description:ORF Clone of Mus musculus interleukin 13 DNA.
Gene Synonym:IL-13
Species:Mouse
Vector:pCMV/hygro
Restriction Site:KpnI + XhoI
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Shipping Carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV/hygro Physical Map

Schematic of pCMV/hygro Multiple Cloning Sites
Other Interleukin & Receptor Related Products
Product nameProduct name
Human IL3 / IL-3 Protein (His Tag)Cynomolgus / Rhesus IL21R / IL-21R Protein (Fc Tag)Human IL3 / IL-3 ProteinMouse IL-21R / Il21R Protein (ECD, His Tag)Rat IL9 / IL-9 Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Mouse CD123 / IL3RA Protein (ECD, His Tag)Cynomolgus CD127 / IL-7RA Protein (His Tag)Human IL-8 / CXCL8 Protein (aa 23-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 23-99)Human IL-8 / CXCL8 Protein (aa 28-99, Fc Tag)Human IL-8 / CXCL8 Protein (aa 28-99)Human IL13 / ALRH Protein (Fc Tag)Human IL13RA2 / CD213A2 Protein (His Tag)Human IL13RA2 / IL13R Protein (His & Fc Tag)Mouse IL2RG Protein (His & Fc Tag)Human IL2Ra / CD25 Protein (Fc Tag)Human CD122 / IL-2RB Protein (Fc Tag)Human CD122 / IL-2RB ProteinCynomolgus IL13 / ALRH ProteinMouse IL-13Ra1 Protein (His & Fc Tag)Mouse IL-34 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His & Fc Tag)Human Interleukin-32 / IL-32 Protein (isoform alpha, His Tag)Human IL4R / CD124 Protein (His Tag)Human IL13RA1 Protein (His & Fc Tag)Human IL7RA / CD127 Protein (His & Fc Tag)Human IL2Ra / CD25 Protein (His Tag)Mouse IL13RA2 / CD213A2 Protein (His Tag)Mouse IL13RA1 Protein (His Tag)Human IL7RA / CD127 Protein (His Tag)Human IL13RA1 Protein (His Tag)Mouse IL7RA / CD127 Protein (His Tag)Human IL3RA / CD123 Protein (His Tag)Human IL3RA / CD123 Protein (His & Fc Tag)Human CD131 / CSF2RB / IL3RB / IL5RB Protein (His Tag)Mouse IL2RG / CD132 Protein (His Tag)Human IL4 / Interleukin-4 ProteinHuman IL-9 / Interleukin-9 Protein (His Tag)Human IL5Ra / CD125 Protein (His Tag)Human IL-3 / Interleukin-3 Protein (His Tag)Mouse IL2RA / CD25 Protein (His Tag)Human IL-21R / Interleukin-21 Receptor Protein (His Tag)Human Interleukin-2 / IL-2 ProteinHuman IL13 / ALRH ProteinMouse IL-4R / CD124 Protein (ECD, His Tag)Cynomolgus IL13 / ALRH Protein (His Tag)Human IL16 / Interleukin-16 Protein (His Tag)Rat Interleukin-2 / IL-2 ProteinHuman IL2RG / CD132 Protein (His Tag)Mouse IL5 Protein (His Tag)Mouse IL4 / Interleukin-4 ProteinCanine Interleukin-2 / IL-2 Protein (147 Cys/Ser)Canine IL5 Protein (His Tag)Rat IL3 / interleukin 3 Protein (His Tag)Mouse Interleukin-2 / IL-2 ProteinCanine IL4 / Interleukin-4 ProteinRat IL4R / Il4ra Protein (His Tag)Human IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (Fc Tag)Rat IL2RG / CD132 Protein (His Tag)Rat IL13RA1 Protein (Fc Tag) Rat IL-21R / Interleukin-21 Receptor Protein (His Tag)Rat IL13RA2 / IL13R Protein (His Tag)Canine IL-8 / CXCL8 ProteinMouse IL13 / ALRH ProteinRat IL7R / IL7RA Protein (Fc Tag)Rat IL13RA2 / IL13R Protein (Fc Tag)Rat CD131 / CSF2RB / IL3RB / IL5RB Protein (Fc Tag)Cynomolgus IL-8 / CXCL8 ProteinMouse IL5Ra / CD125 Protein (His Tag)Rat IL4R / Il4ra Protein (Fc Tag)Mouse IL4 / Interleukin-4 Protein (Q136D, Y139D, His Tag)Cynomolgus IL2RA Protein (His Tag)Rat IL7R / IL7RA Protein (His Tag)Cynomolgus IL2RA Protein (Fc Tag)Canine IL13RA2 / IL13R Protein (His Tag)Cynomolgus IL2RA ProteinCanine IL13RA2 / IL13R Protein (Fc Tag)Human IL5 / Interleukin 5 ProteinMouse CD122 / IL2RB / IL2 Receptor beta Protein (His Tag)Canine IL3RA Protein (His Tag)Canine IL2RB / IL2 Receptor beta Protein (Fc Tag)Human IL-15 / IL15 / Interleukin 15 Protein (His Tag)Human IL2 / Interleukin-2 Protein (L35M, L36S, C142A)Cynomolgus IL-21R / Interleukin-21 Receptor Protein (His Tag)Mouse IL16 / Interleukin-16 Protein (His Tag)
Background

Interleukin 13 (IL-13) is a single-chain glycosylated polypeptide, which belongs to the IL-13/IL-4 family. IL-13 protein is secreted by many cell types, but especially by T helper type 2 (Th2) cells. IL-13 exerts its effects through a multi-subunit receptor comprising the alpha chain of the IL-4 receptor (IL-4Rα) and at least one of two known IL-13-specific binding chains (IL-13 Rα1 and IL-13 Rα2). As a cytokine, IL-13 protein is critical in regulating inflammatory, immune responses and diseases. In addition, it inhibits the production of pro-inflammatory cytokines and chemokines, and thus down-regulates macrophage activity. IL-13 protein and antibody is more importantly implicated as a central mediator of immunoregulatory processes in various cell types.

References
  • Junttila IS, et al. (2008) Tuning sensitivity to IL-4 and IL-13: differential expression of IL-4Ralpha, IL-13Ralpha1, and gammac regulates relative cytokine sensitivity. J Exp Med. 205(11): 2595-608.
  • Shimamura T,et al. (2008) Novel role of IL-13 in fibrosis induced by nonalcoholic steatohepatitis and its amelioration by IL-13R-directed cytotoxin in a rat model. J Immunol. 181(7): 4656-65.
  • Catalog:MG50225-M-N
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability5 business days
    Images
    • Mouse IL13 / ALRH Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"