Quick Order

Mouse IL13/IL-13/ALRH Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse IL13/ALRH cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Mouse IL13/ALRH Gene Plasmid Map
Mouse IL13 / ALRH Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Interleukin 13 (IL-13) is a single-chain glycosylated polypeptide, which belongs to the IL-13/IL-4 family. IL-13 protein is secreted by many cell types, but especially by T helper type 2 (Th2) cells. IL-13 exerts its effects through a multi-subunit receptor comprising the alpha chain of the IL-4 receptor (IL-4Rα) and at least one of two known IL-13-specific binding chains (IL-13 Rα1 and IL-13 Rα2). As a cytokine, IL-13 protein is critical in regulating inflammatory, immune responses and diseases. In addition, it inhibits the production of pro-inflammatory cytokines and chemokines, and thus down-regulates macrophage activity. IL-13 protein and antibody is more importantly implicated as a central mediator of immunoregulatory processes in various cell types.

  • Junttila IS, et al. (2008) Tuning sensitivity to IL-4 and IL-13: differential expression of IL-4Ralpha, IL-13Ralpha1, and gammac regulates relative cytokine sensitivity. J Exp Med. 205(11): 2595-608.
  • Shimamura T,et al. (2008) Novel role of IL-13 in fibrosis induced by nonalcoholic steatohepatitis and its amelioration by IL-13R-directed cytotoxin in a rat model. J Immunol. 181(7): 4656-65.
  • Contact Us
    • Mouse IL13 / ALRH Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.