Quick Order

Human IL11RA/IL-11RA transcript variant 1 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Human IL11RA cDNA Clone Product Information
NCBI RefSeq:
RefSeq ORF Size:
cDNA Description:
Gene Synonym:
Restriction Site:
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:
Antibiotic in E.coli:
Antibiotic in mammalian cell:
Human IL11RA Gene Plasmid Map
Human IL11Ra transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name

Interleukin 11 receptor, alpha subunit (IL11RA/IL-11RA) is a subunit of the interleukin 11 receptor which is a member of the hematopoietic cytokine receptor family. IL11RA/IL-11RA is expressed in a number of cell lines, including the myelogenous leukemia cell line K562, the megakaryocytic leukemia cell line Mo7E, the erythroleukemia cell line TF1, and the osteosarcoma cell lines, MG-63 and Saos-2. It is also expressed in normal and malignant prostate epithelial cell lines. Expression levels are increased in prostate carcinoma. This particular receptor is very similar to ciliary neurotrophic factor, since both contain an extracellular region with a 2-domain structure composed of an immunoglobulin-like domain and a cytokine receptor-like domain. Alternative splicing has been observed at this locus, and three variants encoding two different isoforms have been identified. IL11RA/IL-11RA is a receptor for interleukin-11. The receptor systems for IL6, LIF, OSM, CNTF, IL11 and CT1 can utilize IL6ST for initiating signal transmission. Defects in IL11RA/IL-11RA are a cause of craniosynostosis and dental anomalies (CRSDA). CRSDA is a disorder characterized by craniosynostosis, maxillary hypoplasia, and dental anomalies, including malocclusion, delayed and ectopic tooth eruption, and/or supernumerary teeth. Some patients also display minor digit anomalies, such as syndactyly and/or clinodactyly.

  • Van Leuven F, et al. (1996) Molecular cloning and characterization of the human interleukin-11 receptor alpha-chain gene, IL11RA, located on chromosome 9p13. Genomics. 31 (1): 65-70.
  • Yoshizaki A, et al. (2006) Expression of interleukin (IL)-11 and IL-11 receptor in human colorectal adenocarcinoma: IL-11 up-regulation of the invasive and proliferative activity of human colorectal carcinoma cells. Int J Oncol. 29 (4): 869-76.
  • Karube K, et al. (2006) Gene expression profile of cytokines and chemokines in microdissected primary Hodgkin and Reed-Sternberg (HRS) cells: high expression of interleukin-11 receptor alpha. Ann Oncol. 17 (1): 110-6.
  • Contact Us
    • Human IL11Ra transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.