IL10RB cDNA ORF Clone, Human, untagged

This product is not available, please contact order_us@sinobiological.com for relevant product if required.

IL10RB cDNA ORF Clone, Human, untagged: General Information

Gene
Species
Human
NCBI Ref Seq
RefSeq ORF Size
978 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Human interleukin 10 receptor, beta.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro
Restriction Sites
HindIII + XhoI (5.5kb + 0.98kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

IL10RB cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

IL10RB cDNA ORF Clone, Human, untagged: Alternative Names

CDW210B cDNA ORF Clone, Human; CRF2-4 cDNA ORF Clone, Human; CRFB4 cDNA ORF Clone, Human; D21S58 cDNA ORF Clone, Human; D21S66 cDNA ORF Clone, Human; IL-10R2 cDNA ORF Clone, Human

IL10RB Background Information

Interleukin 1 receptor, beta subunit (IL1RB/IL-1RB) also known as Cytokine receptor family 2 member 4, Interleukin-1 receptor subunit 2, and cytokine receptor family II, member 4, is a subunit for the interleukin-1 receptor. IL1RB/IL-1RB belongs to the cytokine receptor family. It is an accessory chain essential for the active interleukin 1 receptor complex. Coexpression of this and IL1RA proteins has been shown to be required for IL1-induced signal transduction. Defects in IL1RB/IL-1RB are the cause of inflammatory bowel disease type 25 (IBD25). It is a chronic, relapsing inflammation of the gastrointestinal tract with a complex etiology. It is subdivided into Crohn disease and ulcerative colitis phenotypes. Crohn disease may affect any part of the gastrointestinal tract from the mouth to the anus, but most frequently it involves the terminal ileum and colon. Bowel inflammation is transmural and discontinuous; it may contain granulomas or be associated with intestinal or perianal fistulas. In contrast, in ulcerative colitis, the inflammation is continuous and limited to rectal and colonic mucosal layers; fistulas and granulomas are not observed. Both diseases include extraintestinal inflammation of the skin, eyes, or joints.
Full Name
interleukin 10 receptor, beta
References
  • Josephson K, et al. (2001) Crystal structure of the IL-10/IL-10R1 complex reveals a shared receptor binding site. Immunity. 15 (1): 35-46.
  • Yoo KH, et al. (2011) Association of IL10, IL10RA, and IL10RB polymorphisms with benign prostate hyperplasia in Korean population. J Korean Med Sci. 26(5): 659-64.
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait