Interferon Gamma cDNA ORF Clone, Ferret, C-His tag

Cat: FG60007-G-H
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Interferon Gamma Reagents
CRO Services

All Interferon Gamma Reagents
Interferon Gamma cDNA ORF Clone, Ferret, C-His tag General Information
Gene
Species
Ferret
NCBI Ref Seq
RefSeq ORF Size
501 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Ferret Interferon gamma with His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-His
Restriction Sites
KpnI + XhoI (5.5kb + 0.53kb)
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Interferon Gamma cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Interferon Gamma cDNA ORF Clone, Ferret, C-His tag Validated Images
Human Leptin Gene Plasmid Map 7138
Interferon Gamma Background Information

IFN gamma, also known as IFNG, is a secreted protein which belongs to the type I I interferon family. IFN gamma is produced predominantly by natural killer and natural killer T cells as part of the innate immune response, and by CD4 and CD8 cytotoxic T lymphocyte effector T cells once antigen-specific immunity develops. IFN gamma has antiviral, immunoregulatory, and anti-tumor properties. IFNG, in addition to having antiviral activity, has important immunoregulatory functions, it is a potent activator of macrophages, and has antiproliferative effects on transformed cells and it can potentiate the antiviral and antitumor effects of the type I interferons. The IFNG monomer consists of a core of six α-helices and an extended unfolded sequence in the C-terminal region. IFN gamma is critical for innate and adaptive immunity against viral and intracellular bacterial infections and for tumor control. Aberrant IFN gamma expression is associated with a number of autoinflammatory and autoimmune diseases. The importance of IFN gamma in the immune system stems in part from its ability to inhibit viral replication directly, and most importantly from its immunostimulatory and immunomodulatory effects. IFNG also promotes NK cell activity.

Immune Checkpoint   Immunotherapy   Cancer Immunotherapy   Targeted Therapy

Full Name
interferon, gamma
References
  • Gray P W, et al. (1982) Structure of the human immune interferon gene. Nature. 298: 859-63.
  • Taya Y, et al. (1982) Cloning and structure of the human immune interferon-gamma chromosomal gene. EMBO J. 1: 953-8.
  • Goshima N, et al. (2008) Human protein factory for converting the transcriptome into an in vitro-expressed proteome. Nomura N Nat Methods. 5: 1011-7.
  • Thiel DJ, et al. (2000) Observation of an unexpected third receptor molecule in the crystal structure of human interferon-gamma receptor complex. Structure. 8 (9): 927-36.
  • Naylor SL, et al. (1983) Human immune interferon gene is located on chromosome 12. J Exp Med. 157 (3): 1020-7.
  • Schoenborn JR, et al. (2007) Regulation of interferon-gamma during innate and adaptive immune responses. Adv Immunol. 96: 41-101.
  • Interferon Gamma cDNA ORF Clone, Ferret, Related Products

    Product Name Catalog#(PDF)
    Interferon Gamma cDNA ORF Clone in Cloning Vector, Ferret FG60007-G
    Interferon Gamma cDNA ORF Clone, Ferret, untagged FG60007-UT
    Interferon Gamma Lentiviral cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60007-ACGLN
    Interferon Gamma cDNA ORF Clone, Ferret, C-GFPSpark® tag FG60007-ACG
    Interferon Gamma cDNA ORF Clone, Ferret, C-OFPSpark® tag FG60007-ACR
    Interferon Gamma cDNA ORF Clone, Ferret, C-DDK (Flag®) tag FG60007-CF
    Interferon Gamma cDNA ORF Clone, Ferret, N-DDK (Flag®) tag FG60007-NF
    Interferon Gamma cDNA ORF Clone, Ferret, C-His tag FG60007-CH
    Interferon Gamma cDNA ORF Clone, Ferret, N-His tag FG60007-NH
    Interferon Gamma cDNA ORF Clone, Ferret, C-HA tag FG60007-CY
    Interferon Gamma cDNA ORF Clone, Ferret, N-HA tag FG60007-NY
    Interferon Gamma cDNA ORF Clone, Ferret, C-Myc tag FG60007-CM
    Interferon Gamma cDNA ORF Clone, Ferret, N-Myc tag FG60007-NM

    Interferon Gamma cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Interferon Gamma cDNA ORF Clone in Cloning Vector, Rhesus CG90008-M
    Interferon Gamma cDNA ORF Clone, Rhesus, untagged CG90008-UT
    Interferon Gamma cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90008-ACG
    Interferon Gamma Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90008-ACGLN
    Interferon Gamma cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90008-ACR
    Interferon Gamma cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90008-CF
    Interferon Gamma cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90008-NF
    Interferon Gamma cDNA ORF Clone, Rhesus, C-His tag CG90008-CH
    Interferon Gamma cDNA ORF Clone, Rhesus, N-His tag CG90008-NH
    Interferon Gamma cDNA ORF Clone, Rhesus, C-HA tag CG90008-CY
    Interferon Gamma cDNA ORF Clone, Rhesus, N-HA tag CG90008-NY
    Interferon Gamma cDNA ORF Clone, Rhesus, C-Myc tag CG90008-CM
    Interferon Gamma cDNA ORF Clone, Rhesus, N-Myc tag CG90008-NM

    Interferon Gamma cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Interferon Gamma cDNA ORF Clone in Cloning Vector, Rat RG80234-G
    Interferon Gamma cDNA ORF Clone, Rat, untagged RG80234-UT
    Interferon Gamma cDNA ORF Clone, Rat, C-GFPSpark® tag RG80234-ACG
    Interferon Gamma Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80234-ACGLN
    Interferon Gamma cDNA ORF Clone, Rat, C-OFPSpark® tag RG80234-ACR
    Interferon Gamma cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80234-CF
    Interferon Gamma cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80234-NF
    Interferon Gamma cDNA ORF Clone, Rat, C-His tag RG80234-CH
    Interferon Gamma cDNA ORF Clone, Rat, N-His tag RG80234-NH
    Interferon Gamma cDNA ORF Clone, Rat, C-HA tag RG80234-CY
    Interferon Gamma cDNA ORF Clone, Rat, N-HA tag RG80234-NY
    Interferon Gamma cDNA ORF Clone, Rat, C-Myc tag RG80234-CM
    Interferon Gamma cDNA ORF Clone, Rat, N-Myc tag RG80234-NM
    Interferon Gamma qPCR Primer Pairs, Rat RP300221

    Interferon Gamma cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Interferon Gamma cDNA ORF Clone in Cloning Vector, Mouse MG50709-M
    Interferon Gamma cDNA ORF Clone, Mouse, untagged MG50709-UT
    Interferon Gamma Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50709-ACGLN
    Interferon Gamma cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50709-ACG
    Interferon Gamma cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50709-ACR
    Interferon Gamma cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50709-CF
    Interferon Gamma cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50709-NF
    Interferon Gamma cDNA ORF Clone, Mouse, C-His tag MG50709-CH
    Interferon Gamma cDNA ORF Clone, Mouse, N-His tag MG50709-NH
    Interferon Gamma cDNA ORF Clone, Mouse, C-HA tag MG50709-CY
    Interferon Gamma cDNA ORF Clone, Mouse, N-HA tag MG50709-NY
    Interferon Gamma cDNA ORF Clone, Mouse, C-Myc tag MG50709-CM
    Interferon Gamma cDNA ORF Clone, Mouse, N-Myc tag MG50709-NM
    Interferon Gamma qPCR Primer Pairs, Mouse MP200684

    Interferon Gamma cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Interferon Gamma cDNA ORF Clone in Cloning Vector, Human HG11725-G
    Interferon Gamma cDNA ORF Clone, Human, untagged HG11725-UT
    Interferon Gamma cDNA ORF Clone, Human, C-GFPSpark® tag HG11725-ACG
    Interferon Gamma Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11725-ACGLN
    Interferon Gamma cDNA ORF Clone, Human, C-OFPSpark® tag HG11725-ACR
    Interferon Gamma cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11725-CF
    Interferon Gamma cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11725-NF
    Interferon Gamma cDNA ORF Clone, Human, C-His tag HG11725-CH
    Interferon Gamma cDNA ORF Clone, Human, N-His tag HG11725-NH
    Interferon Gamma cDNA ORF Clone, Human, C-HA tag HG11725-CY
    Interferon Gamma cDNA ORF Clone, Human, N-HA tag HG11725-NY
    Interferon Gamma cDNA ORF Clone, Human, C-Myc tag HG11725-CM
    Interferon Gamma cDNA ORF Clone, Human, N-Myc tag HG11725-NM
    Interferon Gamma qPCR Primer Pairs, Human HP102720
    info info
    添加购物车成功! 添加购物车失败!