Quick Order

Text Size:AAA

Human Interferon alpha-B / IFNA8 Gene ORF cDNA clone expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Human IFNA8 cDNA Clone Product Information
NCBI RefSeq:NM_002170.3
RefSeq ORF Size:570bp
cDNA Description:Full length Clone DNA of Homo sapiens interferon, alpha 8 with Flag tag.
Gene Synonym:IFNA8
Restriction Site:KpnI + XhoI (5.4kb + 0.62kb)
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
pCMV2-FLAG Vector Information
Vector Name pCMV2-FLAG
Vector Size 5592bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag FLAG
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

Schematic of pCMV2-FLAG Multiple Cloning Sites

FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name

Interferon alpha-B, also known as IFNA8, belongs to the alpha/beta interferon family. Interferons are proteins made and released by host cells in response to the presence of pathogens such as viruses, bacteria, parasites or tumorcells. Interferon stimulates the production of two enzymes: a protein kinase and an oligoadenylate synthetase. They also allow for communication between cells to trigger the protective defenses of the immune system that eradicate pathogens or tumors. Interferons also activate immune cells, such as natural killer cells and macrophages. They increase recognition of infection or tumor cells by up-regulating antigen presentation to T lymphocytes. They also increase the ability of uninfected host cells to resist new infection by virus. Certain symptoms, such as aching muscles and fever, are related to the production of IFNs during infection. Produced by macrophages, IFN-alpha have antiviral activities.

  • Henco K. et al., 1985, J Mol Biol. 185 (2): 227-60.
  • Goeddel DV. et al., 1981, Nature. 290 (5801): 20-6.
  • Yelverton E. et al., 1981, Nucleic Acids Res. 9 (3): 731-41.
  • Kempaiah P. et al., 2012, Hum Genet. 131 (8): 1375-91.
  • Size / Price
    Catalog: HG10347-M-F
    List Price: 
    Price:      (You Save: )
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.