Interferon alpha 2 cDNA ORF Clone, Human, C-DDK (Flag®) tag

Cat: HG13833-G-F
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Interferon alpha 2 Reagents
CRO Services

All Interferon alpha 2 Reagents
Interferon alpha 2 cDNA ORF Clone, Human, C-DDK (Flag®) tag General Information
Gene
Species
Human
RefSeq ORF Size
567 bp
Sequence Description
A number of silent mutations were introduced into the DNA sequence in order to increase its protein expression level in mammalian cell system. The translated amino acid sequence is identical with NP_000596.2.
Description
Full length Clone DNA of interferon, alpha 2 DNA.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV/hygro-FLAG
Restriction Sites
KpnI + XhoI
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Interferon alpha 2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Interferon alpha 2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Validated Images
Human Interferon alpha 2/IFNA2 Gene Expression validated Image 2476
The plasmid was transfected into 293E adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope.
Human G-CSF/CSF3 Gene Plasmid Map 7153
Interferon alpha 2 cDNA ORF Clone, Human, C-DDK (Flag®) tag Alternative Names
IFN-alphaA cDNA ORF Clone, Human;IFNA cDNA ORF Clone, Human;IFNA2B cDNA ORF Clone, Human;IFNAB cDNA ORF Clone, Human;INFA2 cDNA ORF Clone, Human;Interferon alpha 2 cDNA ORF Clone, Human
Interferon alpha 2 Background Information
Full Name
interferon, alpha 2
References
  • Wang, et al. (2004) Fever of recombinant human interferon-alpha is mediated by opioid domain interaction with opioid receptor inducing prostaglandin E2. J Neuroimmunol. 156(1-2): 107-12.
  • Groopman JE, et al. (1984) Recombinant alpha-2 interferon therapy for Kaposi's sarcoma associated with the acquired immunodeficiency syndrome. Ann Intern Med. 100(5): 671-6.
  • Krueger JM, et al. (1987) Interferon alpha-2 enhances slow-wave sleep in rabbits. Int J Immunopharmacol. 9(1): 23-30.
  • Interferon alpha 2 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Interferon alpha 2 cDNA ORF Clone in Cloning Vector, Rhesus CG90105-G
    Interferon alpha 2 cDNA ORF Clone, Rhesus, untagged CG90105-UT
    Interferon alpha 2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90105-ACG
    Interferon alpha 2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90105-ACGLN
    Interferon alpha 2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90105-ACR
    Interferon alpha 2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90105-CF
    Interferon alpha 2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90105-NF
    Interferon alpha 2 cDNA ORF Clone, Rhesus, C-His tag CG90105-CH
    Interferon alpha 2 cDNA ORF Clone, Rhesus, N-His tag CG90105-NH
    Interferon alpha 2 cDNA ORF Clone, Rhesus, C-HA tag CG90105-CY
    Interferon alpha 2 cDNA ORF Clone, Rhesus, N-HA tag CG90105-NY
    Interferon alpha 2 cDNA ORF Clone, Rhesus, C-Myc tag CG90105-CM
    Interferon alpha 2 cDNA ORF Clone, Rhesus, N-Myc tag CG90105-NM

    Interferon alpha 2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Interferon alpha 2 cDNA ORF Clone in Cloning Vector, Mouse MG50525-M
    Interferon alpha 2 cDNA ORF Clone, Mouse, untagged MG50525-UT
    Interferon alpha 2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50525-ACGLN
    Interferon alpha 2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50525-ACG
    Interferon alpha 2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50525-ACR
    Interferon alpha 2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50525-CF
    Interferon alpha 2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50525-NF
    Interferon alpha 2 cDNA ORF Clone, Mouse, C-His tag MG50525-CH
    Interferon alpha 2 cDNA ORF Clone, Mouse, N-His tag MG50525-NH
    Interferon alpha 2 cDNA ORF Clone, Mouse, C-HA tag MG50525-CY
    Interferon alpha 2 cDNA ORF Clone, Mouse, N-HA tag MG50525-NY
    Interferon alpha 2 cDNA ORF Clone, Mouse, C-Myc tag MG50525-CM
    Interferon alpha 2 cDNA ORF Clone, Mouse, N-Myc tag MG50525-NM
    Interferon alpha 2 qPCR Primer Pairs, Mouse MP200517

    Interferon alpha 2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Interferon alpha 2 cDNA ORF Clone in Cloning Vector, Human HG13833-G
    Interferon alpha 2 cDNA ORF Clone, Human, untagged HG13833-UT
    Interferon alpha 2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13833-ACGLN
    Interferon alpha 2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13833-ACG
    Interferon alpha 2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13833-ACR
    Interferon alpha 2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13833-CF
    Interferon alpha 2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13833-NF
    Interferon alpha 2 cDNA ORF Clone, Human, C-His tag HG13833-CH
    Interferon alpha 2 cDNA ORF Clone, Human, N-His tag HG13833-NH
    Interferon alpha 2 cDNA ORF Clone, Human, C-HA tag HG13833-CY
    Interferon alpha 2 cDNA ORF Clone, Human, N-HA tag HG13833-NY
    Interferon alpha 2 cDNA ORF Clone, Human, C-Myc tag HG13833-CM
    Interferon alpha 2 cDNA ORF Clone, Human, N-Myc tag HG13833-NM
    Interferon alpha 2 qPCR Primer Pairs, Human HP102505
    info info
    添加购物车成功! 添加购物车失败!